Human DMKN(Dermokine) ELISA Kit

Human DMKN(Dermokine) ELISA Kit

Human Dermokine (DMKN) ELISA Kit
RDR-DMKN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 589

Human Dermokine (DMKN) ELISA Kit
RDR-DMKN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 820

Human Dermokine (DMKN) ELISA Kit
RD-DMKN-Hu-48Tests	Reddot Biotech	48 Tests	EUR 563

Human Dermokine (DMKN) ELISA Kit
RD-DMKN-Hu-96Tests	Reddot Biotech	96 Tests	EUR 783

Human Dermokine, DMKN ELISA KIT
ELI-26210h	Lifescience Market	96 Tests	EUR 824

Human Dermokine (DMKN) ELISA Kit
20-abx151295	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Dermokine ELISA Kit (DMKN)
RK01273	Abclonal	96 Tests	EUR 521

Human Dermokine(DMKN)ELISA Kit
QY-E04981	Qayee Biotechnology	96T	EUR 361

Human Dermokine (DMKN) ELISA Kit
SEN221Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5189.65
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermokine (DMKN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermokine (DMKN) in serum, plasma, tissue homogenates and other biological fluids.

Human Dermokine (DMKN) ELISA Kit
SEN221Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 515.03
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermokine (DMKN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermokine (DMKN) in serum, plasma, tissue homogenates and other biological fluids.

Human Dermokine (DMKN) ELISA Kit
SEN221Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 692.9
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermokine (DMKN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermokine (DMKN) in serum, plasma, tissue homogenates and other biological fluids.

Human Dermokine (DMKN) ELISA Kit
SEN221Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2818.05
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermokine (DMKN) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermokine (DMKN) in serum, plasma, tissue homogenates and other biological fluids.

Human Dermokine (DMKN) ELISA Kit
4-SEN221Hu	Cloud-Clone	EUR 5240.00 EUR 2769.00 EUR 693.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Dermokine elisa. Alternative names of the recognized antigen: Epidermis-specific secreted protein SK30/SK89
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dermokine (DMKN) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Dermokine (DMKN) Antibody
20-abx112045	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Dermokine (DMKN) Antibody
20-abx130997	Abbexa	EUR 453.00 EUR 133.00 EUR 1316.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Dermokine (DMKN) Antibody
20-abx172092	Abbexa	EUR 926.00 EUR 467.00	1 mg 200 ug
Please enquire.

Dermokine (DMKN) Antibody
20-abx318297	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dermokine (DMKN) Antibody
abx232425-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant Dermokine (DMKN)
4-RPN221Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q6E0U4 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.1kDa Isoelectric Point: Inquire
Description: Recombinant Human Dermokine expressed in: E.coli

Mouse Dermokine, Dmkn ELISA KIT
ELI-32001m	Lifescience Market	96 Tests	EUR 865

Bovine Dermokine, DMKN ELISA KIT
ELI-48824b	Lifescience Market	96 Tests	EUR 928

Mouse Dermokine (DMKN) ELISA Kit
abx389048-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

ELISA kit for Human DMKN (Dermokine)
ELK6679	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermokine (DMKN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dermokine (DMKN). Show more
Description: A sandwich ELISA kit for detection of Dermokine from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Dermokine (DMKN) Protein
20-abx650808	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Dermokine (DMKN) CLIA Kit
20-abx496087	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Dermokine (DMKN) Antibody (HRP)
20-abx303626	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dermokine (DMKN) Antibody (FITC)
20-abx303627	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dermokine (DMKN) Antibody (Biotin)
20-abx303628	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Dmkn ELISA Kit| Mouse Dermokine ELISA Kit
EF014677	Lifescience Market	96 Tests	EUR 689

DMKN ELISA Kit| Bovine Dermokine ELISA Kit
EF011308	Lifescience Market	96 Tests	EUR 689

Dermokine (DMKN) Polyclonal Antibody (Human)
4-PAN221Hu01	Cloud-Clone	EUR 262.00 EUR 2747.00 EUR 679.00 EUR 331.00 EUR 220.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DMKN (Gly27~Gly238) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN)

Dermokine (DMKN) Polyclonal Antibody (Human), APC
4-PAN221Hu01-APC	Cloud-Clone	EUR 368.00 EUR 3599.00 EUR 993.00 EUR 472.00 EUR 229.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DMKN (Gly27~Gly238) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with APC.

Dermokine (DMKN) Polyclonal Antibody (Human), Biotinylated
4-PAN221Hu01-Biotin	Cloud-Clone	EUR 328.00 EUR 2697.00 EUR 786.00 EUR 404.00 EUR 226.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DMKN (Gly27~Gly238) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with Biotin.

Dermokine (DMKN) Polyclonal Antibody (Human), Cy3
4-PAN221Hu01-Cy3	Cloud-Clone	EUR 449.00 EUR 4757.00 EUR 1283.00 EUR 588.00 EUR 264.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DMKN (Gly27~Gly238) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with Cy3.

Dermokine (DMKN) Polyclonal Antibody (Human), FITC
4-PAN221Hu01-FITC	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DMKN (Gly27~Gly238) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with FITC.

Dermokine (DMKN) Polyclonal Antibody (Human), HRP
4-PAN221Hu01-HRP	Cloud-Clone	EUR 335.00 EUR 3135.00 EUR 877.00 EUR 426.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DMKN (Gly27~Gly238) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with HRP.

Dermokine (DMKN) Polyclonal Antibody (Human), PE
4-PAN221Hu01-PE	Cloud-Clone	EUR 314.00 EUR 2899.00 EUR 814.00 EUR 397.00 EUR 203.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DMKN (Gly27~Gly238) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with PE.

Dermokine (DMKN) Polyclonal Antibody (Human), APC-Cy7
4-PAN221Hu01-APC-Cy7	Cloud-Clone	EUR 616.00 EUR 7078.00 EUR 1867.00 EUR 824.00 EUR 338.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DMKN (Gly27~Gly238) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with APC-Cy7.

DMKN ELISA KIT|Human
EF009137	Lifescience Market	96 Tests	EUR 689

DMKN ELISA Kit (Human) (OKCD00624)
OKCD00624	Aviva Systems Biology	96 Wells	EUR 909
Description: Description of target: May act as a soluble regulator of keratinocyte differentiation.Curated ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

DMKN ELISA Kit (Human) (OKAN06472)
OKAN06472	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

DMKN ELISA Kit (Human) (OKDD00232)
OKDD00232	Aviva Systems Biology	96 Wells	EUR 1053
Description: Description of target: This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.061 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

DMKN siRNA
20-abx914270	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DMKN siRNA
20-abx914271	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DMKN antibody
70R-16863	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DMKN antibody

DMKN Antibody
DF12597	Affbiotech	200ul	EUR 304
Description: DMKN Antibody detects endogenous levels of DMKN.

DMKN Antibody
1-CSB-PA006965GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DMKN. Recognizes DMKN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DMKN Antibody
1-CSB-PA006965LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DMKN. Recognizes DMKN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

Human DMKN shRNA Plasmid
20-abx964186	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

DMKN Recombinant Protein (Human)
RP009463	ABM	100 ug	Ask for price

pET28a-Dermokine gamma Plasmid
PVTB00271-1a	Lifescience Market	2 ug	EUR 356

DMKN cloning plasmid
CSB-CL006965HU1-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 414 Sequence: atgtttaactttgacactttctggaagaattttaaatccaagctgggtttcatcaactgggatgccataaacaagaaccaggtcccgccccccagcacccgagccctcctctacttcagccgactctgggaggatttcaaacagaacactcctttcctcaactggaaagcaattat Show more
Description: A cloning plasmid for the DMKN gene.

anti- DMKN antibody
FNab02425	FN Test	100µg	EUR 505.25
Immunogen: dermokine Uniprot ID: Q6E0U4 Gene ID: 93099 Research Area: Cancer, Immunology
Description: Antibody raised against DMKN

DMKN Polyclonal Antibody
A58810	EpiGentek	100 µg	EUR 570.55
Description: kits suitable for this type of research

DMKN Rabbit pAb
A13871-100ul	Abclonal	100 ul	EUR 308

DMKN Rabbit pAb
A13871-200ul	Abclonal	200 ul	EUR 459

DMKN Rabbit pAb
A13871-20ul	Abclonal	20 ul	EUR 183

DMKN Rabbit pAb
A13871-50ul	Abclonal	50 ul	EUR 223

DMKN Polyclonal Antibody
28391-100ul	SAB	100ul	EUR 252

DMKN Polyclonal Antibody
28391-50ul	SAB	50ul	EUR 187

DMKN Blocking Peptide
DF12597-BP	Affbiotech	1mg	EUR 195

Anti-DMKN antibody
PAab02425	Lifescience Market	100 ug	EUR 355

Anti-DMKN antibody
STJ115810	St John's Laboratory	100 µl	EUR 277
Description: This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.

Human DMKN(Dermokine) ELISA Kit