Human DMKN(Dermokine) ELISA Kit

Human DMKN(Dermokine) ELISA Kit

Human Dermokine (DMKN) ELISA Kit

RDR-DMKN-Hu-48Tests 48 Tests
EUR 589

Human Dermokine (DMKN) ELISA Kit

RDR-DMKN-Hu-96Tests 96 Tests
EUR 820

Human Dermokine (DMKN) ELISA Kit

RD-DMKN-Hu-48Tests 48 Tests
EUR 563

Human Dermokine (DMKN) ELISA Kit

RD-DMKN-Hu-96Tests 96 Tests
EUR 783

Human Dermokine, DMKN ELISA KIT

ELI-26210h 96 Tests
EUR 824

Human Dermokine (DMKN) ELISA Kit

20-abx151295
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Dermokine ELISA Kit (DMKN)

RK01273 96 Tests
EUR 521

Human Dermokine(DMKN)ELISA Kit

QY-E04981 96T
EUR 361

Human Dermokine (DMKN) ELISA Kit

SEN221Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermokine (DMKN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermokine (DMKN) in serum, plasma, tissue homogenates and other biological fluids.

Human Dermokine (DMKN) ELISA Kit

SEN221Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermokine (DMKN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermokine (DMKN) in serum, plasma, tissue homogenates and other biological fluids.

Human Dermokine (DMKN) ELISA Kit

SEN221Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermokine (DMKN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermokine (DMKN) in serum, plasma, tissue homogenates and other biological fluids.

Human Dermokine (DMKN) ELISA Kit

SEN221Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Dermokine (DMKN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Dermokine (DMKN) in serum, plasma, tissue homogenates and other biological fluids.

Human Dermokine (DMKN) ELISA Kit

4-SEN221Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Dermokine elisa. Alternative names of the recognized antigen: Epidermis-specific secreted protein SK30/SK89
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Dermokine (DMKN) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Dermokine (DMKN) Antibody

20-abx112045
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Dermokine (DMKN) Antibody

20-abx130997
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Dermokine (DMKN) Antibody

20-abx172092
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Dermokine (DMKN) Antibody

20-abx318297
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermokine (DMKN) Antibody

abx232425-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Dermokine (DMKN)

4-RPN221Hu01
  • EUR 467.36
  • EUR 228.00
  • EUR 1477.60
  • EUR 559.20
  • EUR 1018.40
  • EUR 376.00
  • EUR 3544.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q6E0U4
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 24.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Dermokine expressed in: E.coli

Mouse Dermokine, Dmkn ELISA KIT

ELI-32001m 96 Tests
EUR 865

Bovine Dermokine, DMKN ELISA KIT

ELI-48824b 96 Tests
EUR 928

Mouse Dermokine (DMKN) ELISA Kit

abx389048-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human DMKN (Dermokine)

ELK6679 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Dermokine (DMKN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Dermokine (DMKN).
  • Show more
Description: A sandwich ELISA kit for detection of Dermokine from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Dermokine (DMKN) Protein

20-abx650808
  • EUR 648.00
  • EUR 272.00
  • EUR 1998.00
  • EUR 773.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Dermokine (DMKN) CLIA Kit

20-abx496087
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Dermokine (DMKN) Antibody (HRP)

20-abx303626
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermokine (DMKN) Antibody (FITC)

20-abx303627
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dermokine (DMKN) Antibody (Biotin)

20-abx303628
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Dmkn ELISA Kit| Mouse Dermokine ELISA Kit

EF014677 96 Tests
EUR 689

DMKN ELISA Kit| Bovine Dermokine ELISA Kit

EF011308 96 Tests
EUR 689

Dermokine (DMKN) Polyclonal Antibody (Human)

4-PAN221Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMKN (Gly27~Gly238)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN)

Dermokine (DMKN) Polyclonal Antibody (Human), APC

4-PAN221Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMKN (Gly27~Gly238)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with APC.

Dermokine (DMKN) Polyclonal Antibody (Human), Biotinylated

4-PAN221Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMKN (Gly27~Gly238)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with Biotin.

Dermokine (DMKN) Polyclonal Antibody (Human), Cy3

4-PAN221Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMKN (Gly27~Gly238)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with Cy3.

Dermokine (DMKN) Polyclonal Antibody (Human), FITC

4-PAN221Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMKN (Gly27~Gly238)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with FITC.

Dermokine (DMKN) Polyclonal Antibody (Human), HRP

4-PAN221Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMKN (Gly27~Gly238)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with HRP.

Dermokine (DMKN) Polyclonal Antibody (Human), PE

4-PAN221Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMKN (Gly27~Gly238)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with PE.

Dermokine (DMKN) Polyclonal Antibody (Human), APC-Cy7

4-PAN221Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DMKN (Gly27~Gly238)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Dermokine (DMKN). This antibody is labeled with APC-Cy7.

DMKN ELISA KIT|Human

EF009137 96 Tests
EUR 689

DMKN ELISA Kit (Human) (OKCD00624)

OKCD00624 96 Wells
EUR 909
Description: Description of target: May act as a soluble regulator of keratinocyte differentiation.Curated ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.054 ng/mL

DMKN ELISA Kit (Human) (OKAN06472)

OKAN06472 96 Wells
EUR 792
Description: Description of target: This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.054 ng/mL

DMKN ELISA Kit (Human) (OKDD00232)

OKDD00232 96 Wells
EUR 1053
Description: Description of target: This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.061 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

DMKN siRNA

20-abx914270
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DMKN siRNA

20-abx914271
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DMKN antibody

70R-16863 50 ul
EUR 435
Description: Rabbit polyclonal DMKN antibody

DMKN Antibody

DF12597 200ul
EUR 304
Description: DMKN Antibody detects endogenous levels of DMKN.

DMKN Antibody

1-CSB-PA006965GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DMKN. Recognizes DMKN from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DMKN Antibody

1-CSB-PA006965LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DMKN. Recognizes DMKN from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:500-1:2000

Human DMKN shRNA Plasmid

20-abx964186
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

DMKN Recombinant Protein (Human)

RP009463 100 ug Ask for price

pET28a-Dermokine gamma Plasmid

PVTB00271-1a 2 ug
EUR 356

DMKN cloning plasmid

CSB-CL006965HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 414
  • Sequence: atgtttaactttgacactttctggaagaattttaaatccaagctgggtttcatcaactgggatgccataaacaagaaccaggtcccgccccccagcacccgagccctcctctacttcagccgactctgggaggatttcaaacagaacactcctttcctcaactggaaagcaattat
  • Show more
Description: A cloning plasmid for the DMKN gene.

anti- DMKN antibody

FNab02425 100µg
EUR 505.25
  • Immunogen: dermokine
  • Uniprot ID: Q6E0U4
  • Gene ID: 93099
  • Research Area: Cancer, Immunology
Description: Antibody raised against DMKN

DMKN Polyclonal Antibody

A58810 100 µg
EUR 570.55
Description: kits suitable for this type of research

DMKN Rabbit pAb

A13871-100ul 100 ul
EUR 308

DMKN Rabbit pAb

A13871-200ul 200 ul
EUR 459

DMKN Rabbit pAb

A13871-20ul 20 ul
EUR 183

DMKN Rabbit pAb

A13871-50ul 50 ul
EUR 223

DMKN Polyclonal Antibody

28391-100ul 100ul
EUR 252

DMKN Polyclonal Antibody

28391-50ul 50ul
EUR 187

DMKN Blocking Peptide

DF12597-BP 1mg
EUR 195

Anti-DMKN antibody

PAab02425 100 ug
EUR 355

Anti-DMKN antibody

STJ115810 100 µl
EUR 277
Description: This gene is upregulated in inflammatory diseases, and it was first observed as expressed in the differentiated layers of skin. The most interesting aspect of this gene is the differential use of promoters and terminators to generate isoforms with unique cellular distributions and domain components. Alternatively spliced transcript variants encoding different isoforms have been identified for this gene.

Human DMKN(Dermokine) ELISA Kit