Human KRT40(Keratin 40) ELISA Kit
Human Keratin 40 (KRT40) ELISA Kit |
RDR-KRT40-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Keratin 40 (KRT40) ELISA Kit |
RDR-KRT40-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
Human Keratin 40 (KRT40) ELISA Kit |
RD-KRT40-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 563 |
Human Keratin 40 (KRT40) ELISA Kit |
RD-KRT40-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Keratin 40 (KRT40) ELISA Kit |
20-abx152115 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Keratin 40 ELISA Kit (KRT40) |
RK01748 |
Abclonal |
96 Tests |
EUR 521 |
Human Keratin 40 (KRT40) ELISA Kit |
SER654Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Keratin 40 (KRT40) ELISA Kit |
SER654Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Keratin 40 (KRT40) ELISA Kit |
SER654Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Keratin 40 (KRT40) ELISA Kit |
SER654Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Keratin 40 (KRT40) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Keratin 40 (KRT40) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Human Keratin 40 (KRT40) ELISA Kit |
4-SER654Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Keratin 40 elisa. Alternative names of the recognized antigen: KA36
- CK-40
- K40
- Cytokeratin-40
- Type I hair keratin Ka36
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Keratin 40 (KRT40) in samples from serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Keratin 40 (KRT40) Antibody |
20-abx177259 |
Abbexa |
|
|
|
Keratin 40 (KRT40) Antibody |
20-abx173252 |
Abbexa |
|
|
|
Keratin 40 (KRT40) Antibody |
20-abx241238 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Keratin 40 (KRT40) Antibody |
20-abx242143 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Human Keratin 40 (KRT40) Protein |
20-abx654106 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Keratin 40 (KRT40) CLIA Kit |
20-abx496227 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human KRT40 (Keratin 40) |
ELK6749 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Keratin 40 (KRT40). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Keratin 40 (KRT
- Show more
|
Description: A sandwich ELISA kit for detection of Keratin 40 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Keratin 40, Type I (KRT40) Antibody |
abx234655-100ug |
Abbexa |
100 ug |
EUR 551 |
- Shipped within 5-12 working days.
|
Keratin 40, Type I (KRT40) Antibody |
20-abx307557 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Keratin, type I cytoskeletal 40, KRT40 ELISA KIT |
ELI-39201h |
Lifescience Market |
96 Tests |
EUR 824 |
Bovine Keratin, type I cytoskeletal 40, KRT40 ELISA KIT |
ELI-14061b |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Keratin, type I cytoskeletal 40, Krt40 ELISA KIT |
ELI-14062m |
Lifescience Market |
96 Tests |
EUR 865 |
ELISA kit for Human Keratin, type I cytoskeletal 40 (KRT40) |
KTE61877-48T |
Abbkine |
48T |
EUR 332 |
- KRT40 encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 40 (KRT40) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Keratin, type I cytoskeletal 40 (KRT40) |
KTE61877-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- KRT40 encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 40 (KRT40) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Keratin, type I cytoskeletal 40 (KRT40) |
KTE61877-96T |
Abbkine |
96T |
EUR 539 |
- KRT40 encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Keratin, type I cytoskeletal 40 (KRT40) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Keratin 40, Type I (KRT40) Antibody (HRP) |
20-abx307558 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Keratin 40, Type I (KRT40) Antibody (FITC) |
20-abx307559 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Keratin 40, Type I (KRT40) Antibody (Biotin) |
20-abx307560 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
DLR-Ab1-40-Hu-48T |
DL Develop |
48T |
EUR 479 |
- Should the Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids. |
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
DLR-Ab1-40-Hu-96T |
DL Develop |
96T |
EUR 621 |
- Should the Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids. |
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
RD-Ab1-40-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
RD-Ab1-40-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
RDR-Ab1-40-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 500 |
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
RDR-Ab1-40-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 692 |
FUNNEL, 40 MM, PP |
6120P-40 |
CORNING |
24/pk |
EUR 44 |
Description: Reusable Plastics; Reusable Funnels |
KRT40 ELISA Kit (Human) (OKAN06471) |
OKAN06471 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.064 ng/mL |
KRT40 ELISA Kit (Human) (OKCD09477) |
OKCD09477 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: < 0.056ng/mL |
KRT40 ELISA Kit (Human) (OKDD00364) |
OKDD00364 |
Aviva Systems Biology |
96 Wells |
EUR 1053 |
Description: Description of target: This gene encodes a member of the type I (acidic) keratin family, which belongs to the superfamily of intermediate filament (IF) proteins. Keratins are heteropolymeric structural proteins which form the intermediate filament. These filaments, along with actin microfilaments and microtubules, compose the cytoskeleton of epithelial cells. The type I keratin genes are clustered in a region of chromosome 17q12-q21.;Species reactivity: Human;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: < 0.064 ng/mL |
Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
DLR-Ab1-40-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids. |
Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
DLR-Ab1-40-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Mouse Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids. |
Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
DLR-Ab1-40-Ra-48T |
DL Develop |
48T |
EUR 508 |
- Should the Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids. |
Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
DLR-Ab1-40-Ra-96T |
DL Develop |
96T |
EUR 661 |
- Should the Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A competitive inhibition quantitative ELISA assay kit for detection of Rat Amyloid Beta Peptide 1-40 (Ab1-40) in samples from serum, plasma or other biological fluids. |
Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
RD-Ab1-40-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
RD-Ab1-40-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
RD-Ab1-40-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
RD-Ab1-40-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
RDR-Ab1-40-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
RDR-Ab1-40-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
RDR-Ab1-40-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 534 |
Rat Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
RDR-Ab1-40-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
ExoDNAPS? Circulating and Exosome-associated DNA Extraction Kit (Human Plasma/Serum, 40 reactions) |
K1230-40 |
Biovision |
|
EUR 1061 |
ExoDNAUC? Circulating and Exosome-associated DNA Extraction Kit (Urine/Cell Media, 40 reactions) |
K1231-40 |
Biovision |
|
EUR 1061 |
DiagNano Gold Nanoparticle Medium Covalent Conjugation Kit, 40 nm |
GCK-M-40 |
Creative Diagnostics |
1 kit |
EUR 757 |
KRT40 Antibody |
35629-100ul |
SAB |
100ul |
EUR 252 |
KRT40 Antibody |
1-CSB-PA696577 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KRT40. Recognizes KRT40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100 |
KRT40 Antibody |
1-CSB-PA718197LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against KRT40. Recognizes KRT40 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
KRT40 Antibody |
1-CSB-PA268168 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against KRT40. Recognizes KRT40 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;ELISA:1:2000-1:5000, WB:1:500-1:2000, IHC:1:50-1:200 |
KRT40 siRNA |
20-abx902904 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KRT40 siRNA |
20-abx922000 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
KRT40 siRNA |
20-abx922001 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Human KRT40 shRNA Plasmid |
20-abx964805 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
KRT40 Recombinant Protein (Human) |
RP040498 |
ABM |
100 ug |
Ask for price |
CORNING® REUSABLE PHENOLIC GPI 40-400 THREADED SCREW CAP WITH RUBBER LINER |
9999-40 |
CORNING |
72/pk |
EUR 140 |
Description: General Apparatus; Stoppers |
Human Connexin 40 ELISA kit |
E01C0591-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Connexin 40 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Connexin 40 ELISA kit |
E01C0591-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Connexin 40 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Connexin 40 ELISA kit |
E01C0591-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Connexin 40 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Heat Shock Protein 40,HSP-40 ELISA Kit |
201-12-1770 |
SunredBio |
96 tests |
EUR 440 |
- This Heat Shock Protein 40 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Human Heat Shock Protein 40,HSP-40 ELISA Kit |
CN-03555H1 |
ChemNorm |
96T |
EUR 473 |
Human Heat Shock Protein 40,HSP-40 ELISA Kit |
CN-03555H2 |
ChemNorm |
48T |
EUR 323 |
Human Heat Shock Protein 40(HSP-40)ELISA Kit |
GA-E1786HM-48T |
GenAsia Biotech |
48T |
EUR 289 |
Human Heat Shock Protein 40(HSP-40)ELISA Kit |
GA-E1786HM-96T |
GenAsia Biotech |
96T |
EUR 466 |
DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 550 nm |
RCK-40-550 |
Creative Diagnostics |
1 kit |
EUR 1043 |
DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 600 nm |
RCK-40-600 |
Creative Diagnostics |
1 kit |
EUR 1043 |
DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 650 nm |
RCK-40-650 |
Creative Diagnostics |
1 kit |
EUR 1043 |
DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 700 nm |
RCK-40-700 |
Creative Diagnostics |
1 kit |
EUR 1043 |
DiagNano Gold Nanorods Covalent Conjugation Kit, diameter 40 nm, absorption max 750 nm |
RCK-40-750 |
Creative Diagnostics |
1 kit |
EUR 1043 |
KRT40 Conjugated Antibody |
C35629 |
SAB |
100ul |
EUR 397 |
KRT40 cloning plasmid |
CSB-CL718197HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1296
- Sequence: atgacttctgactgctcctccacacactgctctcctgagtcctgtggcacggcttccggttgtgcacctgcctcaagctgctccgtggaaacagcttgtctccccggtacctgtgctacatcccgatgtcagactccaagcttcctatccaggtctcgcgggctgactggttgcc
- Show more
|
Description: A cloning plasmid for the KRT40 gene. |
KRT40 Polyclonal Antibody |
A65190 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
anti- KRT40 antibody |
FNab04655 |
FN Test |
100µg |
EUR 585 |
- Recommended dilution: WB: 1:200-1:1000
- Immunogen: keratin 40
- Uniprot ID: Q6A162
- Gene ID: 125115
- Research Area: Signal Transduction
|
Description: Antibody raised against KRT40 |
40 bp random library with flanking sequence; DNA aptamer |
DAL-N-40 |
Alpha Diagnostics |
100 ug |
EUR 408 |
DiagNano Fluorophore Labeled Gold Nanoparticles, 40 nm, Cellular Uptake |
GFL-40-CU |
Creative Diagnostics |
1mL |
EUR 1365 |
KRT40 ORF Vector (Human) (pORF) |
ORF013500 |
ABM |
1.0 ug DNA |
EUR 354 |
DiagNano Gold Nanorods, diameter 40 nm, absorption max 550 nm |
BR-40-550 |
Creative Diagnostics |
25 mL |
EUR 720 |
DiagNano Gold Nanorods, diameter 40 nm, absorption max 600 nm |
BR-40-600 |
Creative Diagnostics |
25 mL |
EUR 720 |
DiagNano Gold Nanorods, diameter 40 nm, absorption max 650 nm |
BR-40-650 |
Creative Diagnostics |
25 mL |
EUR 720 |
DiagNano Gold Nanorods, diameter 40 nm, absorption max 750 nm |
BR-40-750 |
Creative Diagnostics |
25 mL |
EUR 720 |
DiagNano Gold Nanorods, diameter 40 nm, absorption max 780 nm |
BR-40-780 |
Creative Diagnostics |
25 mL |
EUR 720 |
DiagNano Gold Nanorods, diameter 40 nm, absorption max 808 nm |
BR-40-808 |
Creative Diagnostics |
25 mL |
EUR 720 |
DiagNano Gold Nanorods, diameter 40 nm, absorption max 850 nm |
BR-40-850 |
Creative Diagnostics |
25 mL |
EUR 720 |
DiagNano Anti-Human IgA conjugated Gold Nanorods, diameter 40 nm, absorption max 550 nm |
RHA-40-550 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgA conjugated Gold Nanorods, diameter 40 nm, absorption max 600 nm |
RHA-40-600 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgA conjugated Gold Nanorods, diameter 40 nm, absorption max 650 nm |
RHA-40-650 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgA conjugated Gold Nanorods, diameter 40 nm, absorption max 750 nm |
RHA-40-750 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 550 nm |
RHG-40-550 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 600 nm |
RHG-40-600 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 650 nm |
RHG-40-650 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 700 nm |
RHG-40-700 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgG conjugated Gold Nanorods, diameter 40 nm, absorption max 750 nm |
RHG-40-750 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 550 nm |
RHM-40-550 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 600 nm |
RHM-40-600 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 650 nm |
RHM-40-650 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 700 nm |
RHM-40-700 |
Creative Diagnostics |
1 mL |
EUR 1022 |
DiagNano Anti-Human IgM conjugated Gold Nanorods, diameter 40 nm, absorption max 750 nm |
RHM-40-750 |
Creative Diagnostics |
1 mL |
EUR 1022 |
ELISA kit for Human HSP-40 (Heat Shock Protein 40) |
E-EL-H1861 |
Elabscience Biotech |
1 plate of 96 wells |
EUR 377 |
- Gentaur's HSP-40 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human HSP-40. Standards or samples are added to the micro ELISA plate wells and combined wit
- Show more
|
Description: A sandwich ELISA kit for quantitative measurement of Human HSP-40 (Heat Shock Protein 40) in samples from Serum, Plasma, Cell supernatant |
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
abx053393-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
20-abx150496 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
ED1031-096 |
GenDepot |
96T |
EUR 887 |
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
CEA864Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4273.35 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Amyloid Beta Peptide 1-40 (Ab1-40) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in serum, plasma and other biological fluids. |
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
CEA864Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 439.57 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Amyloid Beta Peptide 1-40 (Ab1-40) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in serum, plasma and other biological fluids. |
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
CEA864Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 585.1 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Amyloid Beta Peptide 1-40 (Ab1-40) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in serum, plasma and other biological fluids. |
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
CEA864Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2332.95 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Amyloid Beta Peptide 1-40 (Ab1-40) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: C
- Show more
|
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in serum, plasma and other biological fluids. |
Human Amyloid Beta Peptide 1-40 (Ab1-40) ELISA Kit |
4-CEA864Hu |
Cloud-Clone |
-
EUR 4324.00
-
EUR 2283.00
-
EUR 586.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Amyloid Beta Peptide 1-40 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Human Amyloid Beta Peptide 1-40 (Ab1-40) in samples from Serum, plasma and other biological fluids with no significant corss-reactivity with analogues from other species. |
Human amyloid beta peptide 1-40,Aβ1-40 ELISA Kit |
CN-03356H1 |
ChemNorm |
96T |
EUR 454 |
Human KRT40(Keratin 40) ELISA Kit