Human MARCKSL1(MARCKS Related Protein) ELISA Kit

Human MARCKSL1(MARCKS Related Protein) ELISA Kit

Human MARCKS Related Protein (MARCKSL1) ELISA Kit

RD-MARCKSL1-Hu-48Tests 48 Tests
EUR 563

Human MARCKS Related Protein (MARCKSL1) ELISA Kit

RD-MARCKSL1-Hu-96Tests 96 Tests
EUR 783

Human MARCKS-related protein (MARCKSL1)

1-CSB-EP013494HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 46.5 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human MARCKS-related protein(MARCKSL1) expressed in E.coli

Human MARCKS Related Protein (MARCKSL1) ELISA Kit

20-abx152274
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human MARCKS- related protein, MARCKSL1 ELISA KIT

ELI-38545h 96 Tests
EUR 824

Human MARCKS Related Protein(MARCKSL1)ELISA Kit

QY-E04808 96T
EUR 361

Human MARCKS Related Protein ELISA Kit (MARCKSL1)

RK01818 96 Tests
EUR 521

Human MARCKS Related Protein (MARCKSL1) ELISA Kit

SEL709Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MARCKS Related Protein (MARCKSL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MARCKS Related Protein (MARCKSL1) in tissue homogenates, cell lysates and other biological fluids.

Human MARCKS Related Protein (MARCKSL1) ELISA Kit

SEL709Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MARCKS Related Protein (MARCKSL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MARCKS Related Protein (MARCKSL1) in tissue homogenates, cell lysates and other biological fluids.

Human MARCKS Related Protein (MARCKSL1) ELISA Kit

SEL709Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MARCKS Related Protein (MARCKSL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MARCKS Related Protein (MARCKSL1) in tissue homogenates, cell lysates and other biological fluids.

Human MARCKS Related Protein (MARCKSL1) ELISA Kit

SEL709Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human MARCKS Related Protein (MARCKSL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human MARCKS Related Protein (MARCKSL1) in tissue homogenates, cell lysates and other biological fluids.

Human MARCKS Related Protein (MARCKSL1) ELISA Kit

4-SEL709Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as MARCKS Related Protein elisa. Alternative names of the recognized antigen: MLP1
  • MRP
  • MLP
  • F52
  • MACMARCKS
  • MARCKS-like protein 1
  • Macrophage myristoylated alanine-rich C kinase substrate
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human MARCKS Related Protein (MARCKSL1) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human MARCKS Related Protein (MARCKSL1) Protein

20-abx652263
  • EUR 746.00
  • EUR 300.00
  • EUR 2332.00
  • EUR 885.00
  • EUR 523.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

MARCKS Related Protein (MARCKSL1) Antibody

20-abx177456
  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

MARCKS Related Protein (MARCKSL1) Antibody

20-abx113613
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

MARCKS Related Protein (MARCKSL1) Antibody

20-abx173464
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant MARCKS Related Protein (MARCKSL1)

4-RPL709Hu01
  • EUR 535.46
  • EUR 246.00
  • EUR 1732.96
  • EUR 644.32
  • EUR 1188.64
  • EUR 421.00
  • EUR 4182.40
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P49006
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 45.8kDa
  • Isoelectric Point: 4.7
Description: Recombinant Human MARCKS Related Protein expressed in: E.coli

Mouse MARCKS- related protein, Marcksl1 ELISA KIT

ELI-19405m 96 Tests
EUR 865

Bovine MARCKS- related protein, MARCKSL1 ELISA KIT

ELI-42888b 96 Tests
EUR 928

Rabbit MARCKS- related protein, MARCKSL1 ELISA KIT

ELI-38779Ra 96 Tests
EUR 928

Human MARCKS Related Protein (MARCKSL1) CLIA Kit

20-abx495961
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human MARCKSL1 (MARCKS Related Protein)

ELK6502 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to MARCKS Related Protein (MARCKSL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to
  • Show more
Description: A sandwich ELISA kit for detection of MARCKS Related Protein from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human MARCKS-related protein (MARCKSL1)

KTE62234-48T 48T
EUR 332
  • The myristoylated, alanine-rich protein MARCKS is a widely expressed, prominent substrate for protein kinase C, a key enzyme of intracellular signal transduction. The predicted 200-amino acid protein, which they called F52, shares 52% amino acid iden
  • Show more
Description: Quantitative sandwich ELISA for measuring Human MARCKS-related protein (MARCKSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human MARCKS-related protein (MARCKSL1)

KTE62234-5platesof96wells 5 plates of 96 wells
EUR 2115
  • The myristoylated, alanine-rich protein MARCKS is a widely expressed, prominent substrate for protein kinase C, a key enzyme of intracellular signal transduction. The predicted 200-amino acid protein, which they called F52, shares 52% amino acid iden
  • Show more
Description: Quantitative sandwich ELISA for measuring Human MARCKS-related protein (MARCKSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human MARCKS-related protein (MARCKSL1)

KTE62234-96T 96T
EUR 539
  • The myristoylated, alanine-rich protein MARCKS is a widely expressed, prominent substrate for protein kinase C, a key enzyme of intracellular signal transduction. The predicted 200-amino acid protein, which they called F52, shares 52% amino acid iden
  • Show more
Description: Quantitative sandwich ELISA for measuring Human MARCKS-related protein (MARCKSL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Marcksl1 ELISA Kit| Rat MARCKS-related protein ELISA Kit

EF018939 96 Tests
EUR 689

Marcksl1 ELISA Kit| Mouse MARCKS-related protein ELISA Kit

EF015454 96 Tests
EUR 689

MARCKSL1 ELISA Kit| Bovine MARCKS-related protein ELISA Kit

EF011578 96 Tests
EUR 689

Rat MARCKS-Like Protein 1 (MARCKSL1) ELISA Kit

abx391581-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse MARCKS-Like Protein 1 (MARCKSL1) ELISA Kit

abx389819-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human MARCKS Related Protein ELISA Kit

ELA-E2887h 96 Tests
EUR 824

MARCKSL1 MARCKS-Like 1 Human Recombinant Protein

PROTP49006 Regular: 10ug
EUR 317
Description: MARCKSL1 Human Recombinant produced in E. coli is a single polypeptide chain containing 218 amino acids (1-195) and having a molecular mass of 21.9kDa. MARCKSL1 is fused to a 23 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

MARCKS-Like Protein 1 (MARCKSL1) Antibody

20-abx005386
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

MARCKS-Like Protein 1 (MARCKSL1) Antibody

20-abx003768
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

MARCKS-Like Protein 1 (MARCKSL1) Antibody

abx029067-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

MARCKS-Like Protein 1 (MARCKSL1) Antibody

abx029067-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

MARCKS-Like Protein 1 (MARCKSL1) Antibody

20-abx320787
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

MARCKS-Like Protein 1 (Marcksl1) Antibody

abx235008-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

MARCKS-Like Protein 1 (Marcksl1) Antibody

abx235009-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

MARCKS-Like Protein 1 (MARCKSL1) Antibody

abx235010-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

MARCKS-Like Protein 1 (MARCKSL1) Antibody

abx235011-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit

DLR-MARCKS-Hu-48T 48T
EUR 517
  • Should the Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit

DLR-MARCKS-Hu-96T 96T
EUR 673
  • Should the Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit

RDR-MARCKS-Hu-48Tests 48 Tests
EUR 544

Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit

RDR-MARCKS-Hu-96Tests 96 Tests
EUR 756

Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit

RD-MARCKS-Hu-48Tests 48 Tests
EUR 521

Human Myristoylated Alanine Rich Protein Kinase C Substrate (MARCKS) ELISA Kit

RD-MARCKS-Hu-96Tests 96 Tests
EUR 723

MARCKS-related protein Antibody

20-abx216722
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

MARCKS-related protein Antibody

20-abx121170
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Marcksl1/ Rat Marcksl1 ELISA Kit

ELI-38546r 96 Tests
EUR 886

MARCKS-related protein Blocking Peptide

20-abx161170
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Marcksl1 ELISA KIT|Human

EF010838 96 Tests
EUR 689

Marcks/ Rat Marcks ELISA Kit

ELI-31472r 96 Tests
EUR 886

Human MARCKS ELISA KIT

ELI-15813h 96 Tests
EUR 824

Marcks ELISA KIT|Human

EF010837 96 Tests
EUR 689

MARCKSL1 ELISA Kit (Human) (OKCD02057)

OKCD02057 96 Wells
EUR 909
Description: Description of target: Controls cell movement by regulating actin cytoskeleton homeostasis and filopodium and lamellipodium formation. When unphosphorylated, induces cell migration. When phosphorylated by MAPK8, induces actin bundles formation and stabilization, thereby reducing actin plasticity, hence restricting cell movement, including neuronal migration. May also affect cancer cell migration. May be involved in coupling the protein kinase C and calmodulin signal transduction systems.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.105 ng/mL

Recombinant Human MARCKS-related protein Protein, GST, E.coli-100ug

QP6346-ec-100ug 100ug
EUR 408

Recombinant Human MARCKS-related protein Protein, GST, E.coli-10ug

QP6346-ec-10ug 10ug
EUR 200

Recombinant Human MARCKS-related protein Protein, GST, E.coli-1mg

QP6346-ec-1mg 1mg
EUR 1632

Recombinant Human MARCKS-related protein Protein, GST, E.coli-200ug

QP6346-ec-200ug 200ug
EUR 634

Recombinant Human MARCKS-related protein Protein, GST, E.coli-500ug

QP6346-ec-500ug 500ug
EUR 1060

Recombinant Human MARCKS-related protein Protein, GST, E.coli-50ug

QP6346-ec-50ug 50ug
EUR 263

MARCKSL1 Recombinant Protein (Human)

RP018835 100 ug Ask for price

MARCKSL1 Recombinant Protein (Human)

RP018838 100 ug Ask for price

phospho-Marcks ELISA KIT|Human

EF001747 96 Tests
EUR 689

MARCKS ELISA Kit (Human) (OKCD01967)

OKCD01967 96 Wells
EUR 831
Description: Description of target: MARCKS is the most prominent cellular substrate for protein kinase C. This protein binds calmodulin, actin, and synapsin. MARCKS is a filamentous (F) actin cross-linking protein. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

MARCKS ELISA Kit (Human) (OKCA02125)

OKCA02125 96 Wells
EUR 833
Description: Description of target: MARCKS is the most prominent cellular substrate for protein kinase C. This protein binds calmodulin, actin, and synapsin. MARCKS is a filamentous (F) actin cross-linking protein. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 15.6 pg/mL.

Mouse Marcks ELISA KIT

ELI-22756m 96 Tests
EUR 865

Chicken MARCKS ELISA KIT

ELI-46017c 96 Tests
EUR 928

MARCKS Cell ELISA Kit

abx595367-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Bovine MARCKS ELISA KIT

ELI-39697b 96 Tests
EUR 928

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

MARCKS Recombinant Protein (Human)

RP041242 100 ug Ask for price

Marcksl1 antibody

70R-18414 50 ul
EUR 435
Description: Rabbit polyclonal Marcksl1 antibody

MARCKSL1 Antibody

1-CSB-PA013494DSR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against MARCKSL1. Recognizes MARCKSL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

MARCKSL1 Antibody

1-CSB-PA013494GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against MARCKSL1. Recognizes MARCKSL1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB

MARCKSL1 siRNA

20-abx903161
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MARCKSL1 siRNA

20-abx923569
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

MARCKSL1 siRNA

20-abx923570
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Marcks ELISA Kit (Rat) (OKCD01968)

OKCD01968 96 Wells
EUR 896
Description: Description of target: MARCKS is the most prominent cellular substrate for protein kinase C. This protein binds calmodulin, actin, and synapsin. MARCKS is a filamentous (F) actin cross-linking protein. ;Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.55 ng/mL

MARCKS ELISA Kit (Mouse) (OKEH08184)

OKEH08184 96 Wells
EUR 1092
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.093ng/mL

MARCKSL1 protein (His tag)

80R-2746 20 ug
EUR 322
Description: Purified recombinant MARCKSL1 protein (His tag)

MARCKSL1 Recombinant Protein (Mouse)

RP149480 100 ug Ask for price

MARCKSL1 Recombinant Protein (Rat)

RP210896 100 ug Ask for price

Human MARCKSL1 shRNA Plasmid

20-abx962180
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

phospho-Marcks (phospho-Marcks) Antibody

abx236404-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

phospho-Marcks (phospho-Marcks) Antibody

abx236405-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

MARCKS Colorimetric Cell-Based ELISA Kit

EKC1351 100ul
EUR 572

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

MARCKSL1 Polyclonal Antibody

30833-100ul 100ul
EUR 252

MARCKSL1 Polyclonal Antibody

30833-50ul 50ul
EUR 187

MARCKSL1 cloning plasmid

CSB-CL013494HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 588
  • Sequence: atgggcagccagagctccaaggctccccggggcgacgtgaccgccgaggaggcagcaggcgcttcccccgcgaaggccaacggccaggagaatggccacgtgaaaagcaatggagacttatcccccaagggtgaaggggagtcgccccctgtgaacggaacagatgaggcagccgg
  • Show more
Description: A cloning plasmid for the MARCKSL1 gene.

MARCKSL1 cloning plasmid

CSB-CL013494HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 588
  • Sequence: atgggcagccagagctccaaggctccccggggcgacgtgaccgccgaggaggcagcaggcgcttcccccgcgaaggccaacggccaggagaatggccacgtgaaaagcaatggagacttatcccccaagggtgaaggggagtcgccccctgtgaacggaacagatgaggcagccgg
  • Show more
Description: A cloning plasmid for the MARCKSL1 gene.

MARCKSL1 Rabbit pAb

A7132-100ul 100 ul
EUR 308

MARCKSL1 Rabbit pAb

A7132-200ul 200 ul
EUR 459

MARCKSL1 Rabbit pAb

A7132-20ul 20 ul
EUR 183

Human MARCKSL1(MARCKS Related Protein) ELISA Kit