Human NELL2(NEL Like Protein 2) ELISA Kit

Human NELL2(NEL Like Protein 2) ELISA Kit

Human NEL Like Protein 2 (NELL2) ELISA Kit

RD-NELL2-Hu-96Tests 96 Tests
EUR 783

Human NEL Like Protein 2 (NELL2) ELISA Kit

20-abx152470
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human NEL Like Protein 2(NELL2)ELISA Kit

QY-E04778 96T
EUR 361

Human NEL Like Protein 2 (NELL2) ELISA Kit

SEL934Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NEL Like Protein 2 (NELL2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NEL Like Protein 2 (NELL2) in Tissue homogenates, cell lysates and other biological fluids.

Human NEL Like Protein 2 (NELL2) ELISA Kit

SEL934Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NEL Like Protein 2 (NELL2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NEL Like Protein 2 (NELL2) in Tissue homogenates, cell lysates and other biological fluids.

Human NEL Like Protein 2 (NELL2) ELISA Kit

SEL934Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NEL Like Protein 2 (NELL2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NEL Like Protein 2 (NELL2) in Tissue homogenates, cell lysates and other biological fluids.

Human NEL Like Protein 2 (NELL2) ELISA Kit

SEL934Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human NEL Like Protein 2 (NELL2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human NEL Like Protein 2 (NELL2) in Tissue homogenates, cell lysates and other biological fluids.

Human NEL Like Protein 2 (NELL2) ELISA Kit

4-SEL934Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as NEL Like Protein 2 elisa. Alternative names of the recognized antigen: NRP2
  • Nel-related protein 2
  • Protein kinase C-binding protein NELL2
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human NEL Like Protein 2 (NELL2) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

NEL Like Protein 2 (NELL2) Antibody

abx122896-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

NEL Like Protein 2 (NELL2) Antibody

20-abx129277
  • EUR 453.00
  • EUR 133.00
  • EUR 1316.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

NEL Like Protein 2 (NELL2) Antibody

20-abx173730
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

NEL Like Protein 2 (NELL2) Antibody

abx235660-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

NEL Like Protein 2 (NELL2) Antibody

20-abx334085
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NEL Like Protein 2 (NELL2) Antibody

abx431975-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

Recombinant NEL Like Protein 2 (NELL2)

4-RPL934Hu01
  • EUR 483.49
  • EUR 232.00
  • EUR 1538.08
  • EUR 579.36
  • EUR 1058.72
  • EUR 386.00
  • EUR 3695.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q99435
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human NEL Like Protein 2 expressed in: E.coli

Human NEL Like Protein 2 (NELL2) Protein

20-abx167829
  • EUR 676.00
  • EUR 272.00
  • EUR 2068.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human NEL Like Protein 2 (NELL2) CLIA Kit

20-abx495994
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human NELL2 (NEL Like Protein 2)

ELK6569 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to NEL Like Protein 2 (NELL2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to NEL Lik
  • Show more
Description: A sandwich ELISA kit for detection of NEL Like Protein 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

NEL Like Protein 2 (NELL2) Antibody (HRP)

20-abx337273
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NEL Like Protein 2 (NELL2) Antibody (FITC)

20-abx337274
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NEL Like Protein 2 (NELL2) Antibody (Biotin)

20-abx337275
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

NEL Like Protein 2 (NELL2) Polyclonal Antibody (Human)

4-PAL934Hu01
  • EUR 262.00
  • EUR 2747.00
  • EUR 679.00
  • EUR 331.00
  • EUR 220.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NELL2 (Pro64~Lys331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human NEL Like Protein 2 (NELL2)

NEL Like Protein 2 (NELL2) Polyclonal Antibody (Human), APC

4-PAL934Hu01-APC
  • EUR 368.00
  • EUR 3599.00
  • EUR 993.00
  • EUR 472.00
  • EUR 229.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NELL2 (Pro64~Lys331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human NEL Like Protein 2 (NELL2). This antibody is labeled with APC.

NEL Like Protein 2 (NELL2) Polyclonal Antibody (Human), Biotinylated

4-PAL934Hu01-Biotin
  • EUR 328.00
  • EUR 2697.00
  • EUR 786.00
  • EUR 404.00
  • EUR 226.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NELL2 (Pro64~Lys331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human NEL Like Protein 2 (NELL2). This antibody is labeled with Biotin.

NEL Like Protein 2 (NELL2) Polyclonal Antibody (Human), Cy3

4-PAL934Hu01-Cy3
  • EUR 449.00
  • EUR 4757.00
  • EUR 1283.00
  • EUR 588.00
  • EUR 264.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NELL2 (Pro64~Lys331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human NEL Like Protein 2 (NELL2). This antibody is labeled with Cy3.

NEL Like Protein 2 (NELL2) Polyclonal Antibody (Human), FITC

4-PAL934Hu01-FITC
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NELL2 (Pro64~Lys331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human NEL Like Protein 2 (NELL2). This antibody is labeled with FITC.

NEL Like Protein 2 (NELL2) Polyclonal Antibody (Human), HRP

4-PAL934Hu01-HRP
  • EUR 335.00
  • EUR 3135.00
  • EUR 877.00
  • EUR 426.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NELL2 (Pro64~Lys331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human NEL Like Protein 2 (NELL2). This antibody is labeled with HRP.

NEL Like Protein 2 (NELL2) Polyclonal Antibody (Human), PE

4-PAL934Hu01-PE
  • EUR 314.00
  • EUR 2899.00
  • EUR 814.00
  • EUR 397.00
  • EUR 203.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NELL2 (Pro64~Lys331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human NEL Like Protein 2 (NELL2). This antibody is labeled with PE.

NEL Like Protein 2 (NELL2) Polyclonal Antibody (Human), APC-Cy7

4-PAL934Hu01-APC-Cy7
  • EUR 616.00
  • EUR 7078.00
  • EUR 1867.00
  • EUR 824.00
  • EUR 338.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NELL2 (Pro64~Lys331)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human NEL Like Protein 2 (NELL2). This antibody is labeled with APC-Cy7.

NEL-Like 2 Antibody

20-abx137367
  • EUR 704.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Chicken Protein NEL, NEL ELISA KIT

ELI-39578c 96 Tests
EUR 928

Nel-Like 2 (Chicken) Antibody

20-abx114046
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Nell2/ Rat Nell2 ELISA Kit

ELI-39580r 96 Tests
EUR 886

Human Protein kinase C- binding protein NELL2, NELL2 ELISA KIT

ELI-36501h 96 Tests
EUR 824

NELL2 ELISA KIT|Human

EF001178 96 Tests
EUR 689

Nel-Like 1 (Chicken) Antibody

20-abx114045
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

ELISA kit for Human Protein kinase C-binding protein NELL2 (NELL2)

KTE62220-48T 48T
EUR 332
  • NELL2 encodes a cytoplasmic protein that contains epidermal growth factor (EGF) -like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynosto
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein kinase C-binding protein NELL2 (NELL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein kinase C-binding protein NELL2 (NELL2)

KTE62220-5platesof96wells 5 plates of 96 wells
EUR 2115
  • NELL2 encodes a cytoplasmic protein that contains epidermal growth factor (EGF) -like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynosto
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein kinase C-binding protein NELL2 (NELL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Protein kinase C-binding protein NELL2 (NELL2)

KTE62220-96T 96T
EUR 539
  • NELL2 encodes a cytoplasmic protein that contains epidermal growth factor (EGF) -like repeats. The encoded heterotrimeric protein may be involved in cell growth regulation and differentiation. A similar protein in rodents is involved in craniosynosto
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Protein kinase C-binding protein NELL2 (NELL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Bovine Protein kinase C- binding protein NELL2, NELL2 ELISA KIT

ELI-23245b 96 Tests
EUR 928

Mouse Protein kinase C- binding protein NELL2, Nell2 ELISA KIT

ELI-36502m 96 Tests
EUR 865

NELL2 ELISA Kit (Human) (OKCD01073)

OKCD01073 96 Wells
EUR 909
Description: Description of target: Required for neuron survival through the modulation of MAPK pathways .. Involved in the regulation of hypothalamic GNRH secretion and the control of puberty .;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.115 ng/mL

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

NELL2 Recombinant Protein (Human)

RP021073 100 ug Ask for price

NELL2 antibody

70R-1709 100 ug
EUR 377
Description: Rabbit polyclonal NELL2 antibody

NELL2 antibody

70R-18844 50 ul
EUR 435
Description: Rabbit polyclonal NELL2 antibody

NELL2 antibody

70R-14308 100 ug
EUR 322
Description: Affinity purified Mouse polyclonal NELL2 antibody

NELL2 antibody

10R-1769 100 ul
EUR 316
Description: Mouse Monoclonal NELL2 antibody

NELL2 Antibody

1-CSB-PA859098LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NELL2. Recognizes NELL2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NELL2 Antibody

1-CSB-PA015710GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against NELL2. Recognizes NELL2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

NELL2 siRNA

20-abx925740
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NELL2 siRNA

20-abx925741
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NELL2 Recombinant Protein (Mouse)

RP153695 100 ug Ask for price

NELL2 Recombinant Protein (Rat)

RP213689 100 ug Ask for price

NELL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K1417603 1.0 ug DNA
EUR 154

Human NELL2 shRNA Plasmid

20-abx953156
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

NELL2 Blocking Peptide

33R-5966 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of NELL2 antibody, catalog no. 70R-1709

NELL2 cloning plasmid

CSB-CL859098HU-10ug 10ug
EUR 474
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2451
  • Sequence: atggagtctcgggtcttactgagaacattctgtttgatcttcggtctcggagcagtttgggggcttggtgtggacccttccctacagattgacgtcttaacagagttagaacttggggagtccacgaccggagtgcgtcaggtcccggggctgcataatgggacgaaagcctttc
  • Show more
Description: A cloning plasmid for the NELL2 gene.

anti- NELL2 antibody

FNab05660 100µg
EUR 505.25
  • Immunogen: NEL-like 2
  • Uniprot ID: Q99435
  • Gene ID: 4753
  • Research Area: Neuroscience, Signal Transduction
Description: Antibody raised against NELL2

Anti-NELL2 antibody

PAab05660 100 ug
EUR 355

pCMV-SPORT6-NELL2

PVT13776 2 ug
EUR 391

Anti-NELL2 antibody

STJ73547 100 µg
EUR 359

Anti-NELL2 (2D11)

YF-MA14413 100 ug
EUR 363
Description: Mouse monoclonal to NELL2

Anti-NELL2 (1F6)

YF-MA14414 100 ug
EUR 363
Description: Mouse monoclonal to NELL2

Human Dihydropyrimidinase Like Protein 2 ELISA kit

E01D0257-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropyrimidinase Like Protein 2 ELISA kit

E01D0257-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Dihydropyrimidinase Like Protein 2 ELISA kit

E01D0257-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Dihydropyrimidinase Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fibrinogen Like Protein 2 ELISA kit

E01F0081-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fibrinogen Like Protein 2 ELISA kit

E01F0081-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Fibrinogen Like Protein 2 ELISA kit

E01F0081-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Fibrinogen Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Stomatin Like Protein 2 ELISA kit

E01S0016-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Stomatin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Stomatin Like Protein 2 ELISA kit

E01S0016-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Stomatin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Stomatin Like Protein 2 ELISA kit

E01S0016-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Stomatin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiopoietin Like Protein 2 ELISA kit

E01A0505-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiopoietin Like Protein 2 ELISA kit

E01A0505-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiopoietin Like Protein 2 ELISA kit

E01A0505-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Angiopoietin Like Protein 2 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Angiomotin Like Protein 2 ELISA Kit

ELA-E2296h 96 Tests
EUR 824

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

NELL2 ORF Vector (Human) (pORF)

ORF007025 1.0 ug DNA
EUR 95

NELL2 Protein Vector (Human) (pPB-C-His)

PV028097 500 ng
EUR 329

NELL2 Protein Vector (Human) (pPB-N-His)

PV028098 500 ng
EUR 329

NELL2 Protein Vector (Human) (pPM-C-HA)

PV028099 500 ng
EUR 329

NELL2 Protein Vector (Human) (pPM-C-His)

PV028100 500 ng
EUR 329

Human NELL2(NEL Like Protein 2) ELISA Kit