Human TLL1(Tolloid Like Protein 1) ELISA Kit
Human Tolloid Like Protein 1 (TLL1) ELISA Kit |
RD-TLL1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 783 |
Human Tolloid Like Protein 1 (TLL1) ELISA Kit |
20-abx153313 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Tolloid- like protein 1, TLL1 ELISA KIT |
ELI-17309h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Tolloid Like Protein 1 ELISA Kit (TLL1) |
RK02394 |
Abclonal |
96 Tests |
EUR 521 |
Human Tolloid Like Protein 1 (TLL1) ELISA Kit |
SEM373Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5189.65 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Tolloid Like Protein 1 (TLL1) ELISA Kit |
SEM373Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 515.03 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Tolloid Like Protein 1 (TLL1) ELISA Kit |
SEM373Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 692.9 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Tolloid Like Protein 1 (TLL1) ELISA Kit |
SEM373Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2818.05 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids. |
Human Tolloid Like Protein 1 (TLL1) ELISA Kit |
4-SEM373Hu |
Cloud-Clone |
-
EUR 5240.00
-
EUR 2769.00
-
EUR 693.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Tolloid Like Protein 1 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tolloid Like Protein 1 (TLL1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
Human Tolloid Like Protein 1 (TLL1) Protein |
20-abx655272 |
Abbexa |
-
EUR 815.00
-
EUR 314.00
-
EUR 2611.00
-
EUR 982.00
-
EUR 578.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Tolloid-Like Protein 1 (TLL1) Antibody |
abx025889-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Tolloid-Like Protein 1 (TLL1) Antibody |
abx025889-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Tolloid Like Protein 1 (TLL1) Antibody |
20-abx178636 |
Abbexa |
|
|
|
Tolloid Like Protein 1 (TLL1) Antibody |
20-abx174848 |
Abbexa |
|
|
|
Tolloid-Like Protein 1 (TLL1) Antibody |
20-abx302126 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Chicken Tolloid- like protein 1, TLL1 ELISA KIT |
ELI-16872c |
Lifescience Market |
96 Tests |
EUR 928 |
Mouse Tolloid Like Protein 1 (TLL1) ELISA Kit |
abx390751-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Tolloid- like protein 1, Tll1 ELISA KIT |
ELI-41939m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Tolloid Like Protein 1 (TLL1) CLIA Kit |
20-abx496053 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
ELISA kit for Human TLL1 (Tolloid Like Protein 1) |
ELK6389 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tolloid Like Protein 1 (TLL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Toll
- Show more
|
Description: A sandwich ELISA kit for detection of Tolloid Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Tolloid-Like Protein 1 (TLL1) Antibody (HRP) |
20-abx314365 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tolloid-Like Protein 1 (TLL1) Antibody (FITC) |
20-abx314366 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Tolloid-Like Protein 1 (TLL1) Antibody (Biotin) |
20-abx314367 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
ELISA kit for Chicken Tolloid-like protein 1 (TLL1) |
KTE30019-48T |
Abbkine |
48T |
EUR 354 |
- TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Tolloid-like protein 1 (TLL1) |
KTE30019-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2252 |
- TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Chicken Tolloid-like protein 1 (TLL1) |
KTE30019-96T |
Abbkine |
96T |
EUR 572 |
- TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
- Show more
|
Description: Quantitative sandwich ELISA for measuring Chicken Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tolloid-like protein 1 (TLL1) |
KTE70215-48T |
Abbkine |
48T |
EUR 332 |
- TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tolloid-like protein 1 (TLL1) |
KTE70215-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Mouse Tolloid-like protein 1 (TLL1) |
KTE70215-96T |
Abbkine |
96T |
EUR 539 |
- TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
- Show more
|
Description: Quantitative sandwich ELISA for measuring Mouse Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Tll1 ELISA Kit| Mouse Tolloid-like protein 1 ELISA Kit |
EF016394 |
Lifescience Market |
96 Tests |
EUR 689 |
TLL1 ELISA Kit| chicken Tolloid-like protein 1 ELISA Kit |
EF012540 |
Lifescience Market |
96 Tests |
EUR 689 |
Human Tolloid Like Protein 1 ELISA kit |
E01T0560-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tolloid Like Protein 1 ELISA kit |
E01T0560-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tolloid Like Protein 1 ELISA kit |
E01T0560-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tolloid Like Protein 1 ELISA kit |
E02T0560-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tolloid Like Protein 1 ELISA kit |
E02T0560-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Tolloid Like Protein 1 ELISA kit |
E02T0560-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Tolloid Like Protein 1 ELISA kit |
E04T0560-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Tolloid Like Protein 1 ELISA kit |
E04T0560-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Tolloid Like Protein 1 ELISA kit |
E04T0560-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Tolloid Like Protein 1 ELISA kit |
E03T0560-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Tolloid Like Protein 1 ELISA kit |
E03T0560-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Tolloid Like Protein 1 ELISA kit |
E03T0560-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Tolloid Like Protein 1 ELISA kit |
E08T0560-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Tolloid Like Protein 1 ELISA kit |
E08T0560-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Tolloid Like Protein 1 ELISA kit |
E08T0560-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Tolloid Like Protein 1 ELISA kit |
E07T0560-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Tolloid Like Protein 1 ELISA kit |
E07T0560-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Tolloid Like Protein 1 ELISA kit |
E07T0560-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Tolloid Like Protein 1 ELISA kit |
E09T0560-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Tolloid Like Protein 1 ELISA kit |
E09T0560-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Tolloid Like Protein 1 ELISA kit |
E09T0560-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Monkey Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Tolloid Like Protein 1 ELISA kit |
E06T0560-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Tolloid Like Protein 1 ELISA kit |
E06T0560-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Tolloid Like Protein 1 ELISA kit |
E06T0560-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Guinea pig Tolloid Like Protein 1 ELISA kit |
E05T0560-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Tolloid Like Protein 1 ELISA kit |
E05T0560-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Tolloid Like Protein 1 ELISA kit |
E05T0560-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Guinea pig Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Tolloid- like protein 2, TLL2 ELISA KIT |
ELI-16216h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Tolloid Like Protein 2 (TLL2) ELISA Kit |
abx385476-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Neuropilin and tolloid- like protein 1, NETO1 ELISA KIT |
ELI-23195h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Neuropilin and tolloid-like 1 (NETO1) ELISA Kit |
abx385216-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ELISA kit for Human Tolloid-like protein 2 (TLL2) |
KTE60319-48T |
Abbkine |
48T |
EUR 332 |
- TLL2 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin.TLL2 shares 80.3% amino acid se
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tolloid-like protein 2 (TLL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tolloid-like protein 2 (TLL2) |
KTE60319-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- TLL2 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin.TLL2 shares 80.3% amino acid se
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tolloid-like protein 2 (TLL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Human Tolloid-like protein 2 (TLL2) |
KTE60319-96T |
Abbkine |
96T |
EUR 539 |
- TLL2 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin.TLL2 shares 80.3% amino acid se
- Show more
|
Description: Quantitative sandwich ELISA for measuring Human Tolloid-like protein 2 (TLL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
Recombinant human Neuropilin and tolloid-like protein 1 |
P2693 |
FN Test |
100ug |
Ask for price |
- Uniprot ID: Q8TDF5
- Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
|
Description: Recombinant protein for human Neuropilin and tolloid-like protein 1 |
Mouse Tolloid- like protein 2, Tll2 ELISA KIT |
ELI-16873m |
Lifescience Market |
96 Tests |
EUR 865 |
Mouse Tolloid Like Protein 2 (TLL2) ELISA Kit |
abx390752-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Neuropilin and tolloid- like protein 1, Neto1 ELISA KIT |
ELI-23611m |
Lifescience Market |
96 Tests |
EUR 865 |
Human TLL1 ELISA Kit |
EHT0567 |
Abclonal |
96Tests |
EUR 521 |
Mouse Neuropilin and tolloid-like 1 (NETO1) ELISA Kit |
abx390035-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Tll2 ELISA Kit| Mouse Tolloid-like protein 2 ELISA Kit |
EF016395 |
Lifescience Market |
96 Tests |
EUR 689 |
Human Neuropilin and tolloid- like protein 2, NETO2 ELISA KIT |
ELI-16459h |
Lifescience Market |
96 Tests |
EUR 824 |
Neto1 ELISA Kit| Mouse Neuropilin and tolloid-like protein 1 EL |
EF015674 |
Lifescience Market |
96 Tests |
EUR 689 |
Tolloid-Like Protein 2 (TLL2) Antibody |
abx122418-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Neuropilin And Tolloid-Like 1 (NETO1) Antibody |
abx019143-100ug |
Abbexa |
100 ug |
EUR 342 |
- Shipped within 5-10 working days.
|
Neuropilin and tolloid-like 1 (NETO1) Antibody |
20-abx338376 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
TLL1 ELISA Kit (Human) (OKAN06500) |
OKAN06500 |
Aviva Systems Biology |
96 Wells |
EUR 792 |
Description: Description of target: This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.216 ng/mL |
TLL1 ELISA Kit (Human) (OKCD02072) |
OKCD02072 |
Aviva Systems Biology |
96 Wells |
EUR 909 |
Description: Description of target: Protease which processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Required for the embryonic development. Predominant protease, which in the development, influences dorsal-ventral patterning and skeletogenesis. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.216 ng/mL |
Mouse Neuropilin and tolloid- like protein 2, Neto2 ELISA KIT |
ELI-44722m |
Lifescience Market |
96 Tests |
EUR 865 |
Bovine TLL1 ELISA Kit |
EBT0567 |
Abclonal |
96Tests |
EUR 521 |
Anserini TLL1 ELISA Kit |
EAT0567 |
Abclonal |
96Tests |
EUR 521 |
Chicken TLL1 ELISA Kit |
ECKT0567 |
Abclonal |
96Tests |
EUR 521 |
Canine TLL1 ELISA Kit |
ECT0567 |
Abclonal |
96Tests |
EUR 521 |
Goat TLL1 ELISA Kit |
EGTT0567 |
Abclonal |
96Tests |
EUR 521 |
Sheep TLL1 ELISA Kit |
EST0567 |
Abclonal |
96Tests |
EUR 521 |
Porcine TLL1 ELISA Kit |
EPT0567 |
Abclonal |
96Tests |
EUR 521 |
Rat TLL1 ELISA Kit |
ERT0567 |
Abclonal |
96Tests |
EUR 521 |
Rabbit TLL1 ELISA Kit |
ERTT0567 |
Abclonal |
96Tests |
EUR 521 |
Monkey TLL1 ELISA Kit |
EMKT0567 |
Abclonal |
96Tests |
EUR 521 |
Mouse TLL1 ELISA Kit |
EMT0567 |
Abclonal |
96Tests |
EUR 521 |
Neuropilin and tolloid-like 1 (NETO1) Antibody (HRP) |
20-abx336799 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuropilin and tolloid-like 1 (NETO1) Antibody (FITC) |
20-abx336800 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuropilin and tolloid-like 1 (NETO1) Antibody (Biotin) |
20-abx336801 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Guinea Pig TLL1 ELISA Kit |
EGT0567 |
Abclonal |
96Tests |
EUR 521 |
Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit |
EI1001-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Neuropilin And Tolloid Like 2 (NETO2) Antibody |
20-abx217116 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuropilin And Tolloid Like 2 (NETO2) Antibody |
20-abx308758 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuropilin And Tolloid Like 2 (NETO2) Antibody |
abx235666-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
TLL1 antibody |
31916-100ul |
SAB |
100ul |
EUR 252 |
TLL1 antibody |
31916-50ul |
SAB |
50ul |
EUR 187 |
TLL1 Antibody |
1-CSB-PA023595LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against TLL1. Recognizes TLL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200 |
TLL1 siRNA |
20-abx936877 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
TLL1 siRNA |
20-abx936878 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-TLL1 |
YF-PA15055 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to TLL1 |
anti-TLL1 |
YF-PA15056 |
Abfrontier |
50 ug |
EUR 363 |
Description: Mouse polyclonal to TLL1 |
VSNL1 Visinin-Like Protein-1 Human Recombinant Protein |
PROTP62760-1 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: VSNL1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 191 amino acids (1-191 a.a.) and having a molecular mass of 22.1kDa.;The VSNL1 is purified by proprietary chromatographic techniques. |
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
Human TLL1 shRNA Plasmid |
20-abx954859 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Neuropilin (Nrp) And Tolloid (Tll)-Like 2 Antibody |
20-abx114088 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuropilin And Tolloid Like 2 (NETO2) Antibody (HRP) |
20-abx308759 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuropilin And Tolloid Like 2 (NETO2) Antibody (FITC) |
20-abx308760 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuropilin And Tolloid Like 2 (NETO2) Antibody (Biotin) |
20-abx308761 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
DLK1 Human, Delta-Like 1 Human Recombinant Protein, HEK |
PROTP80370-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: DLK1 Human Recombinant produced in HEK293 Cells is a single, glycosylated, polypeptide chain (a.a 24-303) containing 290 amino acids including a 10 a.a C-terminal His tag. The total molecular mass is 31.2kDa (calculated).  |
FSTL1 Human, Follistatin Like 1 Human Recombinant Protein, HEK |
PROTQ12841-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: FSTL1 Human Recombinant produced in HEK293 cells is a single, glycosylated polypeptide chain (a.a 21-308) containing 296 amino acids including a 8 a.a C-terminal His tag. The total molecular mass is 33.8kDa (calculated). |
IL1RL1 Human, Interleukin-1 Receptor Like-1 Human Recombinant Protein, Sf9 |
PROTQ01638-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: IL 1RL1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (19-328 a.a.) and fused to an 8 aa His Tag at C-terminus containing a total of 318 amino acids and having a molecular mass of 36.0kDa.;IL 1RL1 shows multiple bands between 40-57kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques. |
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit |
EMI1001-1 |
AssayPro |
96 Well Plate |
EUR 477 |
TLL1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K2379302 |
ABM |
1.0 ug DNA |
EUR 154 |
GLP-1 Glucagon Like Peptide-1 (31 a.a.) Human Recombinant Protein |
PROTP01275-1 |
BosterBio |
Regular: 50ug |
EUR 317 |
Description: Glucagon Like Peptide-1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 31 amino acids and having a molecular mass of 3298.7 Dalton. The GLP-1 is purified by proprietary chromatographic techniques. |
TLL1 cloning plasmid |
CSB-CL023595HU-10ug |
Cusabio |
10ug |
EUR 440 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1179
- Sequence: atggggttgggaacgctttccccgaggatgctcgtgtggctggtggcctcggggattgttttctacggggagctatgggtctgcgctggcctcgattatgattacacttttgatgggaacgaagaggataaaacagagactatagattacaaggacccgtgtaaagccgctgtat
- Show more
|
Description: A cloning plasmid for the TLL1 gene. |
TINAGL1 Human, Tubulointerstitial Nephritis Antigen Like 1 Human Recombinant Protein, Sf9 |
PROTQ9GZM7-1 |
BosterBio |
Regular: 5ug |
EUR 317 |
Description: TINAGL1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 455 amino acids (22-467a.a.) and having a molecular mass of 51.2kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). TINAGL1 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques. |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
Anti-Vangl1/Vang Like Protein 1 Antibody |
A07587-1 |
BosterBio |
100ul |
EUR 397 |
Description: Rabbit Polyclonal Antibody for Vangl1 Antibody (VANGL1) detection. Tested with WB in Human, Mouse. |
Human TLL1(Tolloid Like Protein 1) ELISA Kit