Human TLL1(Tolloid Like Protein 1) ELISA Kit

Human TLL1(Tolloid Like Protein 1) ELISA Kit

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
RD-TLL1-Hu-96Tests 96 Tests
EUR 783

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
20-abx153313
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Tolloid- like protein 1, TLL1 ELISA KIT
ELI-17309h 96 Tests
EUR 824

Human Tolloid Like Protein 1(TLL1)ELISA Kit
QY-E04536 96T
EUR 361

Human Tolloid Like Protein 1 ELISA Kit (TLL1)
RK02394 96 Tests
EUR 521

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
SEM373Hu-10x96wellstestplate 10x96-wells test plate
EUR 5189.65
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
SEM373Hu-1x48wellstestplate 1x48-wells test plate
EUR 515.03
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
SEM373Hu-1x96wellstestplate 1x96-wells test plate
EUR 692.9
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
SEM373Hu-5x96wellstestplate 5x96-wells test plate
EUR 2818.05
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Tolloid Like Protein 1 (TLL1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Tolloid Like Protein 1 (TLL1) in serum, plasma, tissue homogenates and other biological fluids.

Human Tolloid Like Protein 1 (TLL1) ELISA Kit
4-SEM373Hu
  • EUR 5240.00
  • EUR 2769.00
  • EUR 693.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Tolloid Like Protein 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Tolloid Like Protein 1 (TLL1) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Human Tolloid Like Protein 1 (TLL1) Protein
20-abx655272
  • EUR 815.00
  • EUR 314.00
  • EUR 2611.00
  • EUR 982.00
  • EUR 578.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Tolloid-Like Protein 1 (TLL1) Antibody
abx025889-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Tolloid-Like Protein 1 (TLL1) Antibody
abx025889-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Tolloid Like Protein 1 (TLL1) Antibody
20-abx178636
  • EUR 1316.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tolloid Like Protein 1 (TLL1) Antibody
20-abx174848
  • EUR 926.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Tolloid-Like Protein 1 (TLL1) Antibody
20-abx302126
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Chicken Tolloid- like protein 1, TLL1 ELISA KIT
ELI-16872c 96 Tests
EUR 928

Mouse Tolloid Like Protein 1 (TLL1) ELISA Kit
abx390751-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Tolloid- like protein 1, Tll1 ELISA KIT
ELI-41939m 96 Tests
EUR 865

Human Tolloid Like Protein 1 (TLL1) CLIA Kit
20-abx496053
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human TLL1 (Tolloid Like Protein 1)
ELK6389 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Tolloid Like Protein 1 (TLL1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Toll
  • Show more
Description: A sandwich ELISA kit for detection of Tolloid Like Protein 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Tolloid-Like Protein 1 (TLL1) Antibody (HRP)
20-abx314365
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tolloid-Like Protein 1 (TLL1) Antibody (FITC)
20-abx314366
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Tolloid-Like Protein 1 (TLL1) Antibody (Biotin)
20-abx314367
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

ELISA kit for Chicken Tolloid-like protein 1 (TLL1)
KTE30019-48T 48T
EUR 354
  • TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Tolloid-like protein 1 (TLL1)
KTE30019-5platesof96wells 5 plates of 96 wells
EUR 2252
  • TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Tolloid-like protein 1 (TLL1)
KTE30019-96T 96T
EUR 572
  • TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tolloid-like protein 1 (TLL1)
KTE70215-48T 48T
EUR 332
  • TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tolloid-like protein 1 (TLL1)
KTE70215-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Tolloid-like protein 1 (TLL1)
KTE70215-96T 96T
EUR 539
  • TLL1 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. A similar protein in mice is required during heart development and specifically processes procollagen C-propeptides and chordin at similar
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Tolloid-like protein 1 (TLL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Tll1 ELISA Kit| Mouse Tolloid-like protein 1 ELISA Kit
EF016394 96 Tests
EUR 689

TLL1 ELISA Kit| chicken Tolloid-like protein 1 ELISA Kit
EF012540 96 Tests
EUR 689

Human Tolloid Like Protein 1 ELISA kit
E01T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tolloid Like Protein 1 ELISA kit
E01T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tolloid Like Protein 1 ELISA kit
E01T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tolloid Like Protein 1 ELISA kit
E02T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tolloid Like Protein 1 ELISA kit
E02T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Tolloid Like Protein 1 ELISA kit
E02T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tolloid Like Protein 1 ELISA kit
E04T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tolloid Like Protein 1 ELISA kit
E04T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Tolloid Like Protein 1 ELISA kit
E04T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tolloid Like Protein 1 ELISA kit
E03T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tolloid Like Protein 1 ELISA kit
E03T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Tolloid Like Protein 1 ELISA kit
E03T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tolloid Like Protein 1 ELISA kit
E08T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tolloid Like Protein 1 ELISA kit
E08T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Tolloid Like Protein 1 ELISA kit
E08T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tolloid Like Protein 1 ELISA kit
E07T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tolloid Like Protein 1 ELISA kit
E07T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Tolloid Like Protein 1 ELISA kit
E07T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tolloid Like Protein 1 ELISA kit
E09T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tolloid Like Protein 1 ELISA kit
E09T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Tolloid Like Protein 1 ELISA kit
E09T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tolloid Like Protein 1 ELISA kit
E06T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tolloid Like Protein 1 ELISA kit
E06T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Tolloid Like Protein 1 ELISA kit
E06T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

Guinea pig Tolloid Like Protein 1 ELISA kit
E05T0560-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Tolloid Like Protein 1 ELISA kit
E05T0560-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Tolloid Like Protein 1 ELISA kit
E05T0560-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Tolloid Like Protein 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Tolloid- like protein 2, TLL2 ELISA KIT
ELI-16216h 96 Tests
EUR 824

Human Tolloid Like Protein 2 (TLL2) ELISA Kit
abx385476-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Neuropilin and tolloid- like protein 1, NETO1 ELISA KIT
ELI-23195h 96 Tests
EUR 824

Human Neuropilin and tolloid-like 1 (NETO1) ELISA Kit
abx385216-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ELISA kit for Human Tolloid-like protein 2 (TLL2)
KTE60319-48T 48T
EUR 332
  • TLL2 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin.TLL2 shares 80.3% amino acid se
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tolloid-like protein 2 (TLL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tolloid-like protein 2 (TLL2)
KTE60319-5platesof96wells 5 plates of 96 wells
EUR 2115
  • TLL2 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin.TLL2 shares 80.3% amino acid se
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tolloid-like protein 2 (TLL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Tolloid-like protein 2 (TLL2)
KTE60319-96T 96T
EUR 539
  • TLL2 encodes an astacin-like zinc-dependent metalloprotease and is a subfamily member of the metzincin family. Unlike other family members, a similar protein in mice does not cleave procollagen C-propeptides or chordin.TLL2 shares 80.3% amino acid se
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Tolloid-like protein 2 (TLL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Recombinant human Neuropilin and tolloid-like protein 1
P2693 100ug Ask for price
  • Uniprot ID: Q8TDF5
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Neuropilin and tolloid-like protein 1

Mouse Tolloid- like protein 2, Tll2 ELISA KIT
ELI-16873m 96 Tests
EUR 865

Mouse Tolloid Like Protein 2 (TLL2) ELISA Kit
abx390752-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Neuropilin and tolloid- like protein 1, Neto1 ELISA KIT
ELI-23611m 96 Tests
EUR 865

Human TLL1 ELISA Kit
EHT0567 96Tests
EUR 521

TLL1 ELISA KIT|Human
EF005652 96 Tests
EUR 689

Mouse Neuropilin and tolloid-like 1 (NETO1) ELISA Kit
abx390035-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Tll2 ELISA Kit| Mouse Tolloid-like protein 2 ELISA Kit
EF016395 96 Tests
EUR 689

Human Neuropilin and tolloid- like protein 2, NETO2 ELISA KIT
ELI-16459h 96 Tests
EUR 824

Neto1 ELISA Kit| Mouse Neuropilin and tolloid-like protein 1 EL
EF015674 96 Tests
EUR 689

Tolloid-Like Protein 2 (TLL2) Antibody
abx122418-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Neuropilin And Tolloid-Like 1 (NETO1) Antibody
abx019143-100ug 100 ug
EUR 342
  • Shipped within 5-10 working days.

Neuropilin and tolloid-like 1 (NETO1) Antibody
20-abx338376
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

TLL1 ELISA Kit (Human) (OKAN06500)
OKAN06500 96 Wells
EUR 792
Description: Description of target: This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.216 ng/mL

TLL1 ELISA Kit (Human) (OKCD02072)
OKCD02072 96 Wells
EUR 909
Description: Description of target: Protease which processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Required for the embryonic development. Predominant protease, which in the development, influences dorsal-ventral patterning and skeletogenesis. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.216 ng/mL

Mouse Neuropilin and tolloid- like protein 2, Neto2 ELISA KIT
ELI-44722m 96 Tests
EUR 865

Bovine TLL1 ELISA Kit
EBT0567 96Tests
EUR 521

Anserini TLL1 ELISA Kit
EAT0567 96Tests
EUR 521

Chicken TLL1 ELISA Kit
ECKT0567 96Tests
EUR 521

Canine TLL1 ELISA Kit
ECT0567 96Tests
EUR 521

Goat TLL1 ELISA Kit
EGTT0567 96Tests
EUR 521

Sheep TLL1 ELISA Kit
EST0567 96Tests
EUR 521

Porcine TLL1 ELISA Kit
EPT0567 96Tests
EUR 521

Rat TLL1 ELISA Kit
ERT0567 96Tests
EUR 521

Rabbit TLL1 ELISA Kit
ERTT0567 96Tests
EUR 521

Monkey TLL1 ELISA Kit
EMKT0567 96Tests
EUR 521

Mouse TLL1 ELISA Kit
EMT0567 96Tests
EUR 521

Neuropilin and tolloid-like 1 (NETO1) Antibody (HRP)
20-abx336799
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin and tolloid-like 1 (NETO1) Antibody (FITC)
20-abx336800
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin and tolloid-like 1 (NETO1) Antibody (Biotin)
20-abx336801
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Guinea Pig TLL1 ELISA Kit
EGT0567 96Tests
EUR 521

Human Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EI1001-1 96 Well Plate
EUR 477

Neuropilin And Tolloid Like 2 (NETO2) Antibody
20-abx217116
  • EUR 425.00
  • EUR 342.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody
20-abx308758
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody
abx235666-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

TLL1 antibody
31916-100ul 100ul
EUR 252

TLL1 antibody
31916-50ul 50ul
EUR 187

TLL1 Antibody
1-CSB-PA023595LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TLL1. Recognizes TLL1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

TLL1 siRNA
20-abx936877
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

TLL1 siRNA
20-abx936878
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-TLL1
YF-PA15055 50 ul
EUR 363
Description: Mouse polyclonal to TLL1

anti-TLL1
YF-PA15056 50 ug
EUR 363
Description: Mouse polyclonal to TLL1

VSNL1 Visinin-Like Protein-1 Human Recombinant Protein
PROTP62760-1 Regular: 50ug
EUR 317
Description: VSNL1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 191 amino acids (1-191 a.a.) and having a molecular mass of 22.1kDa.;The VSNL1 is purified by proprietary chromatographic techniques.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Human TLL1 shRNA Plasmid
20-abx954859
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Neuropilin (Nrp) And Tolloid (Tll)-Like 2 Antibody
20-abx114088
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody (HRP)
20-abx308759
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody (FITC)
20-abx308760
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuropilin And Tolloid Like 2 (NETO2) Antibody (Biotin)
20-abx308761
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

DLK1 Human, Delta-Like 1 Human Recombinant Protein, HEK
PROTP80370-1 Regular: 10ug
EUR 317
Description: DLK1 Human Recombinant produced in HEK293 Cells is a single, glycosylated, polypeptide chain (a.a 24-303) containing 290 amino acids including a 10 a.a C-terminal His tag. The total molecular mass is 31.2kDa (calculated). 

FSTL1 Human, Follistatin Like 1 Human Recombinant Protein, HEK
PROTQ12841-1 Regular: 10ug
EUR 317
Description: FSTL1 Human Recombinant produced in HEK293 cells is a single, glycosylated polypeptide chain (a.a 21-308) containing 296 amino acids including a 8 a.a C-terminal His tag. The total molecular mass is 33.8kDa (calculated).

IL1RL1 Human, Interleukin-1 Receptor Like-1 Human Recombinant Protein, Sf9
PROTQ01638-1 Regular: 10ug
EUR 317
Description: IL 1RL1 produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain (19-328 a.a.) and fused to an 8 aa His Tag at C-terminus containing a total of 318 amino acids and having a molecular mass of 36.0kDa.;IL 1RL1 shows multiple bands between 40-57kDa on SDS-PAGE, reducing conditions and purified by proprietary chromatographic techniques.

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EMI1001-1 96 Well Plate
EUR 477

TLL1 sgRNA CRISPR Lentivector (Human) (Target 1)
K2379302 1.0 ug DNA
EUR 154

GLP-1 Glucagon Like Peptide-1 (31 a.a.) Human Recombinant Protein
PROTP01275-1 Regular: 50ug
EUR 317
Description: Glucagon Like Peptide-1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 31 amino acids and having a molecular mass of 3298.7 Dalton. The GLP-1 is purified by proprietary chromatographic techniques.

TLL1 cloning plasmid
CSB-CL023595HU-10ug 10ug
EUR 440
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1179
  • Sequence: atggggttgggaacgctttccccgaggatgctcgtgtggctggtggcctcggggattgttttctacggggagctatgggtctgcgctggcctcgattatgattacacttttgatgggaacgaagaggataaaacagagactatagattacaaggacccgtgtaaagccgctgtat
  • Show more
Description: A cloning plasmid for the TLL1 gene.

TINAGL1 Human, Tubulointerstitial Nephritis Antigen Like 1 Human Recombinant Protein, Sf9
PROTQ9GZM7-1 Regular: 5ug
EUR 317
Description: TINAGL1 Human Recombinant produced in Sf9 Baculovirus cells is a single, glycosylated polypeptide chain containing 455 amino acids (22-467a.a.) and having a molecular mass of 51.2kDa (Molecular size on SDS-PAGE will appear at approximately 50-70kDa). TINAGL1 is expressed with a 6 amino acid His tag at C-Terminus and purified by proprietary chromatographic techniques.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Anti-Vangl1/Vang Like Protein 1 Antibody
A07587-1 100ul
EUR 397
Description: Rabbit Polyclonal Antibody for Vangl1 Antibody (VANGL1) detection. Tested with WB in Human, Mouse.

Human TLL1(Tolloid Like Protein 1) ELISA Kit