Mouse NEUROG3(Neurogenin 3) ELISA Kit

Mouse NEUROG3(Neurogenin 3) ELISA Kit

Mouse Neurogenin 3 (NEUROG3) ELISA Kit

RD-NEUROG3-Mu-96Tests 96 Tests
EUR 740

Mouse Neurogenin 3 (NEUROG3) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Neurogenin- 3, Neurog3 ELISA KIT

ELI-13651m 96 Tests
EUR 865

Mouse Neurogenin 3 (NEUROG3) ELISA Kit

SEH549Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neurogenin 3 (NEUROG3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neurogenin 3 (NEUROG3) in Tissue homogenates and other biological fluids.

Mouse Neurogenin 3 (NEUROG3) ELISA Kit

SEH549Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neurogenin 3 (NEUROG3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neurogenin 3 (NEUROG3) in Tissue homogenates and other biological fluids.

Mouse Neurogenin 3 (NEUROG3) ELISA Kit

SEH549Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neurogenin 3 (NEUROG3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neurogenin 3 (NEUROG3) in Tissue homogenates and other biological fluids.

Mouse Neurogenin 3 (NEUROG3) ELISA Kit

SEH549Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Neurogenin 3 (NEUROG3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Neurogenin 3 (NEUROG3) in Tissue homogenates and other biological fluids.

Mouse Neurogenin 3 (NEUROG3) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neurogenin 3 elisa. Alternative names of the recognized antigen: Math4B
  • Atoh5
  • ngn3
  • bHLHa7
  • Class A basic helix-loop-helix protein 7
  • Protein atonal homolog 5
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Neurogenin 3 (NEUROG3) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Neurogenin 3 (NEUROG3) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Neurogenin 3 (NEUROG3) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Mouse NEUROG3 (Neurogenin 3)

ELK6561 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neurogenin 3 (NEUROG3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neurogenin
  • Show more
Description: A sandwich ELISA kit for detection of Neurogenin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Neurogenin 3 (NEUROG3) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Neurogenin- 3, NEUROG3 ELISA KIT

ELI-16471h 96 Tests
EUR 824

Human Neurogenin 3(NEUROG3)ELISA Kit

QY-E01624 96T
EUR 413

Neurogenin 3 (NEUROG3) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurogenin 3 (NEUROG3) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neurogenin 3 (NEUROG3) Antibody

  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neurogenin 3 (Neurog3) Antibody

abx011249-100ul 100 ul
EUR 411
  • Shipped within 5-10 working days.

Neurogenin 3 (Neurog3) Antibody

abx031470-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neurogenin 3 (Neurog3) Antibody

abx031470-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neurogenin 3 (NEUROG3) Antibody

abx332378-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Neurogenin 3 (NEUROG3) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Neurogenin 3 (NEUROG3)

  • EUR 512.16
  • EUR 240.00
  • EUR 1645.60
  • EUR 615.20
  • EUR 1130.40
  • EUR 406.00
  • EUR 3964.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9Y4Z2
  • Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 14.2kDa
  • Isoelectric Point: 6.2
Description: Recombinant Human Neurogenin 3 expressed in: E.coli

Human Neurogenin 3 (NEUROG3) Protein

  • EUR 718.00
  • EUR 286.00
  • EUR 2221.00
  • EUR 857.00
  • EUR 509.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neurogenin 3 (NEUROG3) Polyclonal Antibody (Human)

  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEUROG3 (Arg93~Leu214)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenin 3 (NEUROG3)

NEUROG3 Neurogenin 3 Human Recombinant Protein

PROTQ9Y4Z2 Regular: 10ug
EUR 317
Description: NEUROG3 Human Recombinant produced in E.coli is a single, non-glycosylated polypeptide chain containing 234 amino acids (1-214) and having a molecular mass of 25.1 kDa. NEUROG3 is fused to a 20 amino acid His-tag at N-terminus.

Neurogenin 3 (NEUROG3) Polyclonal Antibody (Human), APC

  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEUROG3 (Arg93~Leu214)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenin 3 (NEUROG3). This antibody is labeled with APC.

Neurogenin 3 (NEUROG3) Polyclonal Antibody (Human), Biotinylated

  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEUROG3 (Arg93~Leu214)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenin 3 (NEUROG3). This antibody is labeled with Biotin.

Neurogenin 3 (NEUROG3) Polyclonal Antibody (Human), Cy3

  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEUROG3 (Arg93~Leu214)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenin 3 (NEUROG3). This antibody is labeled with Cy3.

Neurogenin 3 (NEUROG3) Polyclonal Antibody (Human), FITC

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEUROG3 (Arg93~Leu214)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenin 3 (NEUROG3). This antibody is labeled with FITC.

Neurogenin 3 (NEUROG3) Polyclonal Antibody (Human), HRP

  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEUROG3 (Arg93~Leu214)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenin 3 (NEUROG3). This antibody is labeled with HRP.

Neurogenin 3 (NEUROG3) Polyclonal Antibody (Human), PE

  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEUROG3 (Arg93~Leu214)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenin 3 (NEUROG3). This antibody is labeled with PE.

Neurogenin 3 (NEUROG3) Polyclonal Antibody (Human), APC-Cy7

  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NEUROG3 (Arg93~Leu214)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neurogenin 3 (NEUROG3). This antibody is labeled with APC-Cy7.

NEUROG3 ELISA Kit (Mouse) (OKCD09063)

OKCD09063 96 Wells
EUR 1001
Description: Description of target: ;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.054ng/mL

NEUROG3 ELISA Kit (Mouse) (OKDD00757)

OKDD00757 96 Wells
EUR 988
Description: Description of target: Acts as a transcriptional regulator. together with nkx2-2, initiates transcriptional activation of neurod1. involved in neurogenesis. also required for the specification of a common precursor of the 4 pancreatic endocrine cell types.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.054ng/mL

Neurogenin 3 Protein

  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Neurogenin-3 Antibody

BF0446 200ul
EUR 376
Description: Neurogenin-3 antibody detects endogenous levels of total Neurogenin-3.

Mouse Neurogenin- 2, Neurog2 ELISA KIT

ELI-16470m 96 Tests
EUR 865

Mouse Neurogenin- 1, Neurog1 ELISA KIT

ELI-23644m 96 Tests
EUR 865

Mouse Neurogenin-1 (NEUROG1) ELISA Kit

abx390018-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Neurog1 ELISA Kit| Mouse Neurogenin-1 ELISA Kit

EF015657 96 Tests
EUR 689

Neurogenin-3 Blocking Peptide

BF0446-BP 1mg
EUR 195

Anti-Neurogenin 3 antibody

STJ98273 100 µl
EUR 234
Description: Mouse monoclonal to Neurogenin 3.

Human Neurogenin- 1, NEUROG1 ELISA KIT

ELI-13649h 96 Tests
EUR 824

Human Neurogenin- 2, NEUROG2 ELISA KIT

ELI-13650h 96 Tests
EUR 824

Rat Neurogenin-1 (NEUROG1) ELISA Kit

abx391688-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Neurogenin-1 (NEUROG1) ELISA Kit

abx385210-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Neurogenin 2(NEUROG2)ELISA Kit

QY-E01625 96T
EUR 413

Human Neurogenin 1(NEUROG1)ELISA Kit

QY-E01626 96T
EUR 413

Mouse NEUROG3 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Neurog3 Recombinant Protein (Mouse)

RP153785 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Neurog1 ELISA Kit| Rat Neurogenin-1 ELISA Kit

EF019048 96 Tests
EUR 689

NEUROG3 Antibody

35837-100ul 100ul
EUR 252

NEUROG3 antibody

38461-100ul 100ul
EUR 252

NEUROG3 antibody

10R-4972 100 ul
EUR 691
Description: Mouse monoclonal NEUROG3 antibody

NEUROG3 Antibody

EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against NEUROG3. Recognizes NEUROG3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NEUROG3 Antibody

CSB-PA956774-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in pH7.3 PBS, 0.05% NaN3, 50% Glycerol. Antigen Affinity Purified
Description: A polyclonal antibody against NEUROG3. Recognizes NEUROG3 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

NEUROG3 Antibody

DF7077 200ul
EUR 304
Description: NEUROG3 Antibody detects endogenous levels of total NEUROG3.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NEUROG3 Antibody

ABD7077 100 ug
EUR 438


YF-PA18746 100 ug
EUR 403
Description: Rabbit polyclonal to NEUROG3

Neurog3 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4456204 1.0 ug DNA
EUR 154

neurogenin 2 Antibody

39281-100ul 100ul
EUR 390

Neurogenin 1 Antibody

39325-100ul 100ul
EUR 390

anti-Neurogenin 1

YF-PA24231 50 ul
EUR 334
Description: Mouse polyclonal to Neurogenin 1

Neurog3 ORF Vector (Mouse) (pORF)

ORF051263 1.0 ug DNA
EUR 506

NEUROG3 cloning plasmid

CSB-CL896521HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 645
  • Sequence: atgacgcctcaaccctcgggtgcgcccactgtccaagtgacccgtgagacggagcggtccttccccagagcctcggaagacgaagtgacctgccccacgtccgccccgcccagccccactcgcacacgggggaactgcgcagaggcggaagagggaggctgccgaggggccccgag
  • Show more
Description: A cloning plasmid for the NEUROG3 gene.

NEUROG3 Blocking Peptide

DF7077-BP 1mg
EUR 195

NEUROG3 Conjugated Antibody

C35837 100ul
EUR 397

NEUROG3 Conjugated Antibody

C38461 100ul
EUR 397

NEUROG3 Rabbit pAb

A2772-100ul 100 ul
EUR 308

NEUROG3 Rabbit pAb

A2772-200ul 200 ul
EUR 459

NEUROG3 Rabbit pAb

A2772-20ul 20 ul
EUR 183

NEUROG3 Rabbit pAb

A2772-50ul 50 ul
EUR 223

Mouse NEUROG3(Neurogenin 3) ELISA Kit