Mouse PODN(Podocan) ELISA Kit

Mouse PODN(Podocan) ELISA Kit

Mouse Podocan (PODN) ELISA Kit

RDR-PODN-Mu-96Tests 96 Tests
EUR 774

Mouse Podocan (PODN) ELISA Kit

RD-PODN-Mu-48Tests 48 Tests
EUR 533

Mouse Podocan (PODN) ELISA Kit

RD-PODN-Mu-96Tests 96 Tests
EUR 740

Human Podocan (PODN) ELISA Kit

EUR 517
  • Should the Human Podocan (PODN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Podocan (PODN) in samples from tissue homogenates or other biological fluids.

Human Podocan (PODN) ELISA Kit

EUR 673
  • Should the Human Podocan (PODN) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Podocan (PODN) in samples from tissue homogenates or other biological fluids.

Human Podocan (PODN) ELISA Kit

RDR-PODN-Hu-48Tests 48 Tests
EUR 544

Human Podocan (PODN) ELISA Kit

RDR-PODN-Hu-96Tests 96 Tests
EUR 756

Human Podocan (PODN) ELISA Kit

RD-PODN-Hu-48Tests 48 Tests
EUR 521

Human Podocan (PODN) ELISA Kit

RD-PODN-Hu-96Tests 96 Tests
EUR 723

Mouse Podocan (PODN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Podocan, Podn ELISA KIT

ELI-15360m 96 Tests
EUR 865

Mouse Podocan (PODN) ELISA Kit

SEG186Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Podocan (PODN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Podocan (PODN) in Tissue homogenates and other biological fluids.

Mouse Podocan (PODN) ELISA Kit

SEG186Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Podocan (PODN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Podocan (PODN) in Tissue homogenates and other biological fluids.

Mouse Podocan (PODN) ELISA Kit

SEG186Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Podocan (PODN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Podocan (PODN) in Tissue homogenates and other biological fluids.

Mouse Podocan (PODN) ELISA Kit

SEG186Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Podocan (PODN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Podocan (PODN) in Tissue homogenates and other biological fluids.

Mouse Podocan (PODN) ELISA Kit

  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Podocan elisa. Alternative names of the recognized antigen: PCAN
  • SLRR5A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Podocan (PODN) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Podocan (PODN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Podocan (PODN) Protein

  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Mouse PODN (Podocan)

ELK6375 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Podocan (PODN). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Podocan (PODN). Nex
  • Show more
Description: A sandwich ELISA kit for detection of Podocan from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Mouse Podocan (PODN) CLIA Kit

  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Podocan, PODN ELISA KIT

ELI-21623h 96 Tests
EUR 824

Human Podocan (PODN) ELISA Kit

  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-12 working days.

Human Podocan(PODN)ELISA Kit

QY-E04692 96T
EUR 361

for Podocan (PODN)ELISA kit

SEG186Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Podocan (PODN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Podocan (PODN) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

for Podocan (PODN)ELISA kit

SEG186Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Podocan (PODN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Podocan (PODN) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

for Podocan (PODN)ELISA kit

SEG186Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Podocan (PODN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Podocan (PODN) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

for Podocan (PODN)ELISA kit

SEG186Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Podocan (PODN) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Podocan (PODN) in Tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

ELISA Kit for Podocan (PODN)

  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Podocan elisa. Alternative names of the recognized antigen: PCAN
  • SLRR5A
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Podocan (PODN) in samples from Tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Podocan (PODN) Antibody

  • EUR 411.00
  • EUR 133.00
  • EUR 1149.00
  • EUR 565.00
  • EUR 314.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Podocan (PODN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Podocan (PODN) Antibody

  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Podocan (PODN) Antibody

  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Podocan (PODN) Antibody

abx036713-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Podocan (PODN) Antibody

abx031133-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Podocan (PODN) Antibody

abx031133-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Podocan (PODN) Antibody

abx236596-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Podocan (PODN) Antibody

  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Recombinant Podocan (PODN)

  • EUR 391.20
  • EUR 208.00
  • EUR 1192.00
  • EUR 464.00
  • EUR 828.00
  • EUR 325.00
  • EUR 2830.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Inquire
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 63.1kDa
  • Isoelectric Point: 8
Description: Recombinant Human Podocan expressed in: E.coli

Podn ELISA Kit| Mouse Podocan ELISA Kit

EF015905 96 Tests
EUR 689

PODN ELISA Kit (Mouse) (OKCD08896)

OKCD08896 96 Wells
EUR 1001
Description: Description of target: Negatively regulates cell proliferation and cell migration, especially in smooth muscle cells.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.057ng/mL

PODN ELISA Kit (Mouse) (OKDD00717)

OKDD00717 96 Wells
EUR 988
Description: Description of target: Negatively regulates cell proliferation and cell migration, especially in smooth muscle cells.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.057 ng/mL


EF001908 96 Tests
EUR 689

Mouse Podocan- like protein 1, Podnl1 ELISA KIT

ELI-12744m 96 Tests
EUR 865

Mouse PODN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PODN Recombinant Protein (Mouse)

RP163223 100 ug Ask for price

PODN Antibody

39852-100ul 100ul
EUR 390

PODN Antibody

DF10168 200ul
EUR 304
Description: PODN Antibody detects endogenous levels of total PODN.

PODN Antibody

  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PODN. Recognizes PODN from Human. This antibody is Unconjugated. Tested in the following application: IHC, ELISA;IHC:1/100-1/300.ELISA:1/40000


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PODN Antibody

ABD10168 100 ug
EUR 438


YF-PA22141 50 ug
EUR 363
Description: Mouse polyclonal to PODN

ELISA kit for Mouse Podocan-like protein 1 (PODNL1)

KTE70716-48T 48T
EUR 332
  • PODNL1, Belongs to the small leucine-rich proteoglycan (SLRP) family. SLRP class V subfamily. Studies of mice lacking specific members of the small leucine rich repeat proteoglycan (SLRP) family show that many of these connective tissue components ha
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Podocan-like protein 1 (PODNL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Podocan-like protein 1 (PODNL1)

KTE70716-5platesof96wells 5 plates of 96 wells
EUR 2115
  • PODNL1, Belongs to the small leucine-rich proteoglycan (SLRP) family. SLRP class V subfamily. Studies of mice lacking specific members of the small leucine rich repeat proteoglycan (SLRP) family show that many of these connective tissue components ha
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Podocan-like protein 1 (PODNL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Podocan-like protein 1 (PODNL1)

KTE70716-96T 96T
EUR 539
  • PODNL1, Belongs to the small leucine-rich proteoglycan (SLRP) family. SLRP class V subfamily. Studies of mice lacking specific members of the small leucine rich repeat proteoglycan (SLRP) family show that many of these connective tissue components ha
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Podocan-like protein 1 (PODNL1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

Podocan Polyclonal Antibody

ABP53729-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Podocan
  • Applications tips:
Description: A polyclonal antibody for detection of Podocan from Human. This Podocan antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Podocan

Podocan Polyclonal Antibody

ABP53729-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Podocan
  • Applications tips:
Description: A polyclonal antibody for detection of Podocan from Human. This Podocan antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Podocan

Podocan Polyclonal Antibody

ABP53729-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human Podocan
  • Applications tips:
Description: A polyclonal antibody for detection of Podocan from Human. This Podocan antibody is for IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human Podocan

Podocan Polyclonal Antibody

ES4728-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against Podocan from Human. This antibody is tested and validated for IHC, WB, ELISA

Podocan Polyclonal Antibody

ES4728-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against Podocan from Human. This antibody is tested and validated for IHC, WB, ELISA

Anti-Podocan antibody

STJ95173 200 µl
EUR 197
Description: Rabbit polyclonal to Podocan.

Podn ORF Vector (Mouse) (pORF)

ORF054409 1.0 ug DNA
EUR 506

Human Podocan- like protein 1, PODNL1 ELISA KIT

ELI-15317h 96 Tests
EUR 824

PODN Polyclonal Antibody

28497-100ul 100ul
EUR 252

PODN Polyclonal Antibody

28497-50ul 50ul
EUR 187

PODN Rabbit pAb

A14309-100ul 100 ul
EUR 308

PODN Rabbit pAb

A14309-200ul 200 ul
EUR 459

PODN Rabbit pAb

A14309-20ul 20 ul
EUR 183

PODN Rabbit pAb

A14309-50ul 50 ul
EUR 223

PODN Blocking Peptide

DF10168-BP 1mg
EUR 195

PODN cloning plasmid

CSB-CL018291HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1209
  • Sequence: atgttcaacggctccagcaacgtcgaggtcctcatcctgtccagcaacttcctgcgccacgtgcccaagcacctgccgcctgccctgtacaagctgcacctcaagaacaacaagctggagaagatccccccgggggccttcagcgagctgagcagcctgcgcgagctatacctgc
  • Show more
Description: A cloning plasmid for the PODN gene.

PODN cloning plasmid

CSB-CL018291HU2-10ug 10ug
EUR 376
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1986
  • Sequence: atggaaggagcccgagcccgcggagcgcagctgagactgggggagcgcgttcggcctgtggggcgccgctcggcgccggggcgcagcaggttccatcagccctggcgcccaggcgcatctgactcggcaccccctgcaggcaccatggcccagagccgggtgctgctgctcctgc
  • Show more
Description: A cloning plasmid for the PODN gene.

PODN Rabbit pAb

A9063-100ul 100 ul
EUR 308

PODN Rabbit pAb

A9063-200ul 200 ul
EUR 459

PODN Rabbit pAb

A9063-20ul 20 ul Ask for price

PODN Rabbit pAb

A9063-50ul 50 ul Ask for price

anti- PODN antibody

FNab06596 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500-1:1000
  • Immunogen: podocan
  • Uniprot ID: Q7Z5L7
  • Gene ID: 127435
  • Research Area: Signal Transduction, Developmental biology
Description: Antibody raised against PODN

Anti-PODN antibody

PAab06596 100 ug
EUR 355

Anti-PODN antibody

STJ111548 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the small leucine-rich repeat protein family and contains an amino terminal CX3CXCX7C cysteine-rich cluster followed by a leucine-rich repeat domain. Studies suggest that this protein could function to inhibit smooth muscle cell proliferation and migration following arterial injury.

Anti-PODN antibody

STJ116521 100 µl
EUR 277
Description: The protein encoded by this gene is a member of the small leucine-rich repeat protein family and contains an amino terminal CX3CXCX7C cysteine-rich cluster followed by a leucine-rich repeat domain. Studies suggest that this protein could function to inhibit smooth muscle cell proliferation and migration following arterial injury.

Podn sgRNA CRISPR Lentivector set (Mouse)

K3683401 3 x 1.0 ug
EUR 339

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Human PODN shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PODN Polyclonal Conjugated Antibody

C28497 100ul
EUR 397


PVT16198 2 ug
EUR 325

PODN Recombinant Protein (Human)

RP023992 100 ug Ask for price

PODN Recombinant Protein (Human)

RP023995 100 ug Ask for price

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Podn sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3683402 1.0 ug DNA
EUR 154

Podn sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3683403 1.0 ug DNA
EUR 154

Podn sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3683404 1.0 ug DNA
EUR 154

PODN Protein Vector (Mouse) (pPB-C-His)

PV217634 500 ng
EUR 603

PODN Protein Vector (Mouse) (pPB-N-His)

PV217635 500 ng
EUR 603

PODN Protein Vector (Mouse) (pPM-C-HA)

PV217636 500 ng
EUR 603

PODN Protein Vector (Mouse) (pPM-C-His)

PV217637 500 ng
EUR 603

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Podocan-Like Protein 1 (PODNL1) Antibody

abx026656-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Podocan-Like Protein 1 (PODNL1) Antibody

abx026656-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Polyclonal PODN Antibody(C-term)

AMM07258G 0.1ml
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human PODN (C-term). This antibody is tested and proven to work in the following applications:

PODN ORF Vector (Human) (pORF)

ORF007998 1.0 ug DNA
EUR 95

PODN ORF Vector (Human) (pORF)

ORF007999 1.0 ug DNA
EUR 95

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Mouse PODN(Podocan) ELISA Kit