Mouse PRPH(Peripherin) ELISA Kit

Mouse PRPH(Peripherin) ELISA Kit

Mouse Peripherin (PRPH) ELISA Kit

RDR-PRPH-Mu-96Tests 96 Tests
EUR 774

Mouse Peripherin (PRPH) ELISA Kit

RD-PRPH-Mu-48Tests 48 Tests
EUR 533

Mouse Peripherin (PRPH) ELISA Kit

RD-PRPH-Mu-96Tests 96 Tests
EUR 740

Human Peripherin (PRPH) ELISA Kit

DLR-PRPH-Hu-48T 48T
EUR 517
  • Should the Human Peripherin (PRPH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peripherin (PRPH) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Peripherin (PRPH) ELISA Kit

DLR-PRPH-Hu-96T 96T
EUR 673
  • Should the Human Peripherin (PRPH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Peripherin (PRPH) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Peripherin (PRPH) ELISA Kit

RDR-PRPH-Hu-48Tests 48 Tests
EUR 544

Human Peripherin (PRPH) ELISA Kit

RDR-PRPH-Hu-96Tests 96 Tests
EUR 756

Human Peripherin (PRPH) ELISA Kit

RD-PRPH-Hu-48Tests 48 Tests
EUR 521

Human Peripherin (PRPH) ELISA Kit

RD-PRPH-Hu-96Tests 96 Tests
EUR 723

Mouse Peripherin (PRPH) ELISA Kit

20-abx154531
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Peripherin, Prph ELISA KIT

ELI-43671m 96 Tests
EUR 865

Mouse Peripherin (PRPH) ELISA Kit

abx571118-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse Peripherin (PRPH) ELISA Kit

SEF752Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peripherin (PRPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peripherin (PRPH) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Peripherin (PRPH) ELISA Kit

SEF752Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peripherin (PRPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peripherin (PRPH) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Peripherin (PRPH) ELISA Kit

SEF752Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peripherin (PRPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peripherin (PRPH) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Peripherin (PRPH) ELISA Kit

SEF752Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Peripherin (PRPH) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Peripherin (PRPH) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Peripherin (PRPH) ELISA Kit

4-SEF752Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Peripherin elisa. Alternative names of the recognized antigen: NEF4
  • Neurofilament 4
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Peripherin (PRPH) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse PRPH (Peripherin)

ELK6407 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Peripherin (PRPH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Peripherin (PRPH
  • Show more
Description: A sandwich ELISA kit for detection of Peripherin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Peripherin (PRPH)

KTE71434-48T 48T
EUR 332
  • Peripherin, a type III intermediate filament protein, was initially described by Portier et al. (1984) as a cytoskeletal protein present in neurons of the mammalian peripheral nervous system (hence, the name) and in cultured neuroblastoma cells. The
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Peripherin (PRPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Peripherin (PRPH)

KTE71434-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Peripherin, a type III intermediate filament protein, was initially described by Portier et al. (1984) as a cytoskeletal protein present in neurons of the mammalian peripheral nervous system (hence, the name) and in cultured neuroblastoma cells. The
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Peripherin (PRPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Peripherin (PRPH)

KTE71434-96T 96T
EUR 539
  • Peripherin, a type III intermediate filament protein, was initially described by Portier et al. (1984) as a cytoskeletal protein present in neurons of the mammalian peripheral nervous system (hence, the name) and in cultured neuroblastoma cells. The
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Peripherin (PRPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Peripherin (PRPH) CLIA Kit

20-abx494992
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Peripherin (PRPH) Protein

20-abx654685
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Peripherin (PRPH) Protein

20-abx654686
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human PRPH/ Peripherin ELISA Kit

E2057Hu 1 Kit
EUR 605

Bovine Peripherin, PRPH ELISA KIT

ELI-16037b 96 Tests
EUR 928

Human Peripherin, PRPH ELISA KIT

ELI-45913h 96 Tests
EUR 824

Human Peripherin (PRPH) ELISA Kit

abx555494-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Rat Peripherin (PRPH) ELISA Kit

abx555716-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Cow Peripherin (PRPH) ELISA Kit

abx555781-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Peripherin(PRPH)ELISA Kit

QY-E01121 96T
EUR 400

Prph ELISA Kit| Mouse Peripherin ELISA Kit

EF015831 96 Tests
EUR 689

Peripherin (PRPH) Antibody

20-abx008816
  • EUR 300.00
  • EUR 439.00
  • EUR 189.00
  • 100 ul
  • 200 ul
  • 30 ul
  • Shipped within 5-10 working days.

Peripherin (PRPH) Antibody

20-abx002973
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peripherin (PRPH) Antibody

20-abx177957
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Peripherin (PRPH) Antibody

20-abx177958
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Peripherin (PRPH) Antibody

20-abx114395
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peripherin (PRPH) Antibody

20-abx013177
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Peripherin (PRPH) Antibody

20-abx241262
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peripherin (PRPH) Antibody

20-abx241263
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peripherin (PRPH) Antibody

20-abx320906
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peripherin (PRPH) Antibody

20-abx320907
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Peripherin (PRPH) Antibody

abx236316-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Peripherin (PRPH) Antibody

20-abx330180
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Peripherin (PRPH) Antibody

abx332815-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

ELISA kit for Rat Peripherin (PRPH)

KTE100410-48T 48T
EUR 332
  • Peripherin, a type III intermediate filament protein, was initially described by Portier et al. (1984) as a cytoskeletal protein present in neurons of the mammalian peripheral nervous system (hence, the name) and in cultured neuroblastoma cells. The
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Peripherin (PRPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Peripherin (PRPH)

KTE100410-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Peripherin, a type III intermediate filament protein, was initially described by Portier et al. (1984) as a cytoskeletal protein present in neurons of the mammalian peripheral nervous system (hence, the name) and in cultured neuroblastoma cells. The
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Peripherin (PRPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Peripherin (PRPH)

KTE100410-96T 96T
EUR 539
  • Peripherin, a type III intermediate filament protein, was initially described by Portier et al. (1984) as a cytoskeletal protein present in neurons of the mammalian peripheral nervous system (hence, the name) and in cultured neuroblastoma cells. The
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Peripherin (PRPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Peripherin (PRPH)

KTE61117-48T 48T
EUR 332
  • Peripherin, a type III intermediate filament protein, was initially described by Portier et al. (1984) as a cytoskeletal protein present in neurons of the mammalian peripheral nervous system (hence, the name) and in cultured neuroblastoma cells. The
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Peripherin (PRPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Peripherin (PRPH)

KTE61117-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Peripherin, a type III intermediate filament protein, was initially described by Portier et al. (1984) as a cytoskeletal protein present in neurons of the mammalian peripheral nervous system (hence, the name) and in cultured neuroblastoma cells. The
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Peripherin (PRPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Peripherin (PRPH)

KTE61117-96T 96T
EUR 539
  • Peripherin, a type III intermediate filament protein, was initially described by Portier et al. (1984) as a cytoskeletal protein present in neurons of the mammalian peripheral nervous system (hence, the name) and in cultured neuroblastoma cells. The
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Peripherin (PRPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Peripherin (PRPH)

KTE10166-48T 48T
EUR 354
  • Peripherin, a type III intermediate filament protein, was initially described by Portier et al. (1984) as a cytoskeletal protein present in neurons of the mammalian peripheral nervous system (hence, the name) and in cultured neuroblastoma cells. The
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Peripherin (PRPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Peripherin (PRPH)

KTE10166-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Peripherin, a type III intermediate filament protein, was initially described by Portier et al. (1984) as a cytoskeletal protein present in neurons of the mammalian peripheral nervous system (hence, the name) and in cultured neuroblastoma cells. The
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Peripherin (PRPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Peripherin (PRPH)

KTE10166-96T 96T
EUR 572
  • Peripherin, a type III intermediate filament protein, was initially described by Portier et al. (1984) as a cytoskeletal protein present in neurons of the mammalian peripheral nervous system (hence, the name) and in cultured neuroblastoma cells. The
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Peripherin (PRPH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Prph ELISA Kit| Rat Peripherin ELISA Kit

EF019150 96 Tests
EUR 689

PRPH ELISA Kit| Bovine Peripherin ELISA Kit

EF011734 96 Tests
EUR 689

Anti-Peripherin PRPH Antibody

M06787-1 100ul
EUR 397
Description: Rabbit Polyclonal Peripherin PRPH Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Anti-Peripherin 1 PRPH Monoclonal Antibody

M06787 100ul
EUR 397
Description: Mouse Monoclonal Peripherin 1 PRPH Antibody. Validated in IF, IHC, WB and tested in Bovine, Human, Mouse, Pig, Rat.

Anti-Chicken Polyoclonal Peripherin PRPH Antibody

M06787-2 100ul
EUR 397
Description: Chicken Polyclonal Chicken Polyoclonal Peripherin PRPH Antibody. Validated in IHC, WB and tested in Human, Mouse, Rat.

Prph/ Rat Prph ELISA Kit

ELI-21560r 96 Tests
EUR 886

Prph ELISA Kit (Mouse) (OKCD01881)

OKCD01881 96 Wells
EUR 857
Description: Description of target: Class-III neuronal intermediate filament protein. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.059 ng/mL

PRPH ELISA Kit (Mouse) (OKDD00724)

OKDD00724 96 Wells
EUR 988
Description: Description of target: May function as an adhesion molecule involved in stabilization and compaction of outer segment disks or in the maintenance of the curvature of the rim. it is essential for disk morphogenesis.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.048 ng/mL

Peripherin Cell ELISA Kit

abx595474-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Mouse Peripherin- 2, Prph2 ELISA KIT

ELI-30580m 96 Tests
EUR 865

PRPH ELISA KIT|Human

EF005411 96 Tests
EUR 689

Peripherin

CH22111 100 ul
EUR 370

Peripherin

CH23016 200 ul
EUR 461

Peripherin

MO22106 100 ul
EUR 409

Peripherin

RA22109 100 ul
EUR 409

ELISA kit for Mouse Peripherin-2 (PRPH2)

KTE70645-48T 48T
EUR 332
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Peripherin-2 (PRPH2)

KTE70645-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Peripherin-2 (PRPH2)

KTE70645-96T 96T
EUR 539
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Peripherin

EK3698 96 tests
EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Peripherin in samples from serum, plasma, tissue homogenates and other biological fluids.

PRPH ELISA Kit (Human) (OKEH03505)

OKEH03505 96 Wells
EUR 844
Description: Description of target: This gene encodes a cytoskeletal protein found in neurons of the peripheral nervous system. The encoded protein is a type III intermediate filament protein with homology to other cytoskeletal proteins such as desmin and is a different protein that the peripherin found in photoreceptors. Mutations in this gene have been associated with susceptibility to amyotrophic lateral sclerosis.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Competitive ELISA;Sensitivity: 0.156 ng/mL

Peripherin antibody

23057-100ul 100ul
EUR 390

Peripherin antibody

70R-12630 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal Peripherin antibody

Peripherin antibody

70R-30721 100 ug
EUR 327
Description: Rabbit polyclonal Peripherin antibody

Peripherin Antibody

33471-100ul 100ul
EUR 252

Peripherin Antibody

33471-50ul 50ul
EUR 187

Peripherin antibody

70R-50273 100 ul
EUR 244
Description: Purified Polyclonal Peripherin antibody

Peripherin Antibody

AF0242 200ul
EUR 304
Description: Peripherin antibody detects endogenous levels of total Peripherin.

Peripherin Antibody

ABF0242 100 ug
EUR 438

anti-Peripherin

YF-PA14057 50 ul
EUR 363
Description: Mouse polyclonal to Peripherin

anti-Peripherin

YF-PA14058 100 ug
EUR 403
Description: Rabbit polyclonal to Peripherin

anti-Peripherin

YF-PA24482 50 ul
EUR 334
Description: Mouse polyclonal to Peripherin

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Peripherin Colorimetric Cell-Based ELISA Kit

EKC1452 100ul
EUR 572

Bovine Peripherin- 2, PRPH2 ELISA KIT

ELI-19670b 96 Tests
EUR 928

Human Peripherin 2 (PRPH2) ELISA Kit

abx382485-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Peripherin- 2, PRPH2 ELISA KIT

ELI-37855h 96 Tests
EUR 824

Chicken Peripherin- 2, PRPH2 ELISA KIT

ELI-36881c 96 Tests
EUR 928

Human Peripherin 2(PRPH2)ELISA Kit

QY-E01120 96T
EUR 361

PRPH Recombinant Protein (Mouse)

RP164831 100 ug Ask for price

PRPH Recombinant Protein (Mouse)

RP164834 100 ug Ask for price

PRPH Recombinant Protein (Mouse)

RP164837 100 ug Ask for price

PRPH antibody

20R-2868 100 ul
EUR 349
Description: Chicken polyclonal PRPH antibody

PRPH antibody

70R-19552 50 ul
EUR 435
Description: Rabbit polyclonal PRPH antibody

PRPH antibody

70R-10635 200 ul
EUR 430
Description: Affinity purified Chicken polyclonal PRPH antibody

PRPH antibody

70R-2612 50 ug
EUR 467
Description: Rabbit polyclonal PRPH antibody raised against the N terminal of PRPH

PRPH antibody

70R-2613 50 ug
EUR 467
Description: Rabbit polyclonal PRPH antibody raised against the middle region of PRPH

PRPH Antibody

35875-100ul 100ul
EUR 252

PRPH antibody

10R-8373 100 ul
EUR 349
Description: Mouse monoclonal PRPH antibody

PRPH Antibody

1-CSB-PA830841
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRPH. Recognizes PRPH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PRPH Antibody

1-CSB-PA003858
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against PRPH. Recognizes PRPH from Human, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/20000

PRPH Antibody

1-CSB-PA952925
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against PRPH. Recognizes PRPH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:25-1:100

PRPH Antibody

CSB-PA250115-
EUR 335
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRPH. Recognizes PRPH from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

PRPH Antibody

CSB-PA250115-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Rabbit IgG in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific
  • Show more
Description: A polyclonal antibody against PRPH. Recognizes PRPH from Human, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC;WB:1:500-1:3000, IHC:1:50-1:100

PRPH Antibody

1-CSB-PA018774ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PRPH. Recognizes PRPH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PRPH Antibody

1-CSB-PA018774ESR2HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against PRPH. Recognizes PRPH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

PRPH Antibody

1-CSB-PA018774GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against PRPH. Recognizes PRPH from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

PRPH siRNA

20-abx929932
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

Anti-Peripherin 1 (mouse) antibody

STJ73400 100 µg
EUR 359

ELISA kit for Rat Peripherin-2 (PRPH2)

KTE100409-48T 48T
EUR 332
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Peripherin-2 (PRPH2)

KTE100409-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Peripherin-2 (PRPH2)

KTE100409-96T 96T
EUR 539
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Peripherin-2 (PRPH2)

KTE61116-48T 48T
EUR 332
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Peripherin-2 (PRPH2)

KTE61116-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Peripherin-2 (PRPH2)

KTE61116-96T 96T
EUR 539
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Peripherin-2 (PRPH2)

KTE10165-48T 48T
EUR 354
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Peripherin-2 (PRPH2)

KTE10165-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Bovine Peripherin-2 (PRPH2)

KTE10165-96T 96T
EUR 572
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Bovine Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Peripherin-2 (PRPH2)

KTE20039-48T 48T
EUR 354
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Peripherin-2 (PRPH2)

KTE20039-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Canine Peripherin-2 (PRPH2)

KTE20039-96T 96T
EUR 572
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Canine Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Peripherin-2 (PRPH2)

KTE30056-48T 48T
EUR 354
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Peripherin-2 (PRPH2)

KTE30056-5platesof96wells 5 plates of 96 wells
EUR 2252
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Chicken Peripherin-2 (PRPH2)

KTE30056-96T 96T
EUR 572
  • Peripherin 2 is a cell surface glycoprotein found in the outer segment of both rod and cone photoreceptor cells. It is located in the rim regions of the flattened disks that contain rhodopsin, which is the protein that is responsible for initiation o
  • Show more
Description: Quantitative sandwich ELISA for measuring Chicken Peripherin-2 (PRPH2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Peripherin Colorimetric Cell-Based ELISA Kit (OKAG00963)

OKAG00963 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

Peripherin Blocking Peptide

20-abx063148
  • EUR 272.00
  • EUR 411.00
  • 1 mg
  • 5 mg
  • Shipped within 5-10 working days.

Peripherin Blocking Peptide

AF0242-BP 1mg
EUR 195

Peripherin Conjugated Antibody

C33471 100ul
EUR 397

Peripherin 1 Antibody

abx431523-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

anti- Peripherin antibody

FNab06316 100µg
EUR 505.25
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: peripherin
  • Uniprot ID: P41219
  • Gene ID: 5630
  • Research Area: Neuroscience, Immunology, Developmental biology
Description: Antibody raised against Peripherin

Anti-Peripherin antibody

PAab06316 100 ug
EUR 355

Anti-Peripherin (3B3)

YF-MA14965 100 ug
EUR 363
Description: Mouse monoclonal to Peripherin

Prph ORF Vector (Mouse) (pORF)

ORF054945 1.0 ug DNA
EUR 506

Prph ORF Vector (Mouse) (pORF)

ORF054946 1.0 ug DNA
EUR 506

Prph ORF Vector (Mouse) (pORF)

ORF054947 1.0 ug DNA
EUR 506

PRPH Blocking Peptide

33R-10156 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRPH antibody, catalog no. 70R-2613

PRPH Blocking Peptide

33R-7897 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of PRPH antibody, catalog no. 70R-2612

PRPH Polyclonal Antibody

41362-100ul 100ul
EUR 252

PRPH Polyclonal Antibody

41362-50ul 50ul
EUR 187

PRPH Conjugated Antibody

C35875 100ul
EUR 397

PRPH cloning plasmid

CSB-CL018774HU-10ug 10ug
EUR 506
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1413
  • Sequence: atgagccaccacccgtcgggcctccgggccggcttcagctccacctcataccgccgtaccttcggtccaccgccctcactatcccccggggccttctcctactcgtccagctcccgcttctccagcagccgcctgctgggctccgcgtccccgagctcctcggtgcgcctgggca
  • Show more
Description: A cloning plasmid for the PRPH gene.

PRPH Polyclonal Antibody

ABP52265-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PRPH at AA range: 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of PRPH from Human, Rat. This PRPH antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRPH at AA range: 390-470

PRPH Polyclonal Antibody

ABP52265-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PRPH at AA range: 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of PRPH from Human, Rat. This PRPH antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRPH at AA range: 390-470

PRPH Polyclonal Antibody

ABP52265-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from the C-terminal region of human PRPH at AA range: 390-470
  • Applications tips:
Description: A polyclonal antibody for detection of PRPH from Human, Rat. This PRPH antibody is for WB, IHC-P, ELISA. It is affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from the C-terminal region of human PRPH at AA range: 390-470

PRPH Rabbit pAb

A4048-100ul 100 ul
EUR 308

Mouse PRPH(Peripherin) ELISA Kit