Mouse PTMS(Parathymosin) ELISA Kit

Mouse PTMS(Parathymosin) ELISA Kit

Mouse Parathymosin (PTMS) ELISA Kit

RDR-PTMS-Mu-48Tests 48 Tests
EUR 557

Mouse Parathymosin (PTMS) ELISA Kit

RDR-PTMS-Mu-96Tests 96 Tests
EUR 774

Human Parathymosin (PTMS) ELISA Kit

DLR-PTMS-Hu-48T 48T
EUR 517
  • Should the Human Parathymosin (PTMS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Parathymosin (PTMS) in samples from serum, plasma or other biological fluids.

Human Parathymosin (PTMS) ELISA Kit

DLR-PTMS-Hu-96T 96T
EUR 673
  • Should the Human Parathymosin (PTMS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Parathymosin (PTMS) in samples from serum, plasma or other biological fluids.

Rat Parathymosin (PTMS) ELISA Kit

DLR-PTMS-Ra-48T 48T
EUR 549
  • Should the Rat Parathymosin (PTMS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Parathymosin (PTMS) in samples from serum, plasma or other biological fluids.

Rat Parathymosin (PTMS) ELISA Kit

DLR-PTMS-Ra-96T 96T
EUR 718
  • Should the Rat Parathymosin (PTMS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Parathymosin (PTMS) in samples from serum, plasma or other biological fluids.

Human Parathymosin (PTMS) ELISA Kit

RD-PTMS-Hu-48Tests 48 Tests
EUR 521

Human Parathymosin (PTMS) ELISA Kit

RD-PTMS-Hu-96Tests 96 Tests
EUR 723

Rat Parathymosin (PTMS) ELISA Kit

RD-PTMS-Ra-48Tests 48 Tests
EUR 557

Rat Parathymosin (PTMS) ELISA Kit

RD-PTMS-Ra-96Tests 96 Tests
EUR 775

Human Parathymosin (PTMS) ELISA Kit

RDR-PTMS-Hu-48Tests 48 Tests
EUR 544

Human Parathymosin (PTMS) ELISA Kit

RDR-PTMS-Hu-96Tests 96 Tests
EUR 756

Rat Parathymosin (PTMS) ELISA Kit

RDR-PTMS-Ra-48Tests 48 Tests
EUR 583

Rat Parathymosin (PTMS) ELISA Kit

RDR-PTMS-Ra-96Tests 96 Tests
EUR 811

Mouse Parathymosin (PTMS) ELISA Kit

CED220Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Parathymosin (PTMS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Parathymosin (PTMS) in serum, plasma and other biological fluids.

Mouse Parathymosin (PTMS) ELISA Kit

CED220Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Parathymosin (PTMS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Parathymosin (PTMS) in serum, plasma and other biological fluids.

Mouse Parathymosin (PTMS) ELISA Kit

CED220Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Parathymosin (PTMS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Parathymosin (PTMS) in serum, plasma and other biological fluids.

Mouse Parathymosin (PTMS) ELISA Kit

CED220Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Parathymosin (PTMS) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Competitive Enzyme-linked immunosorbent assay for detection of Mouse Parathymosin (PTMS) in serum, plasma and other biological fluids.

Mouse Parathymosin (PTMS) ELISA Kit

4-CED220Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Parathymosin elisa. Alternative names of the recognized antigen: ParaT
Description: Enzyme-linked immunosorbent assay based on the Competitive Inhibition method for detection of Mouse Parathymosin (PTMS) in samples from Serum, plasma and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Parathymosin, Ptms ELISA KIT

ELI-15073m 96 Tests
EUR 865

Mouse Parathymosin (PTMS) ELISA Kit

20-abx154506
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Parathymosin (PTMS) Protein

20-abx654655
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Parathymosin (PTMS) Protein

20-abx654656
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

ELISA kit for Mouse PTMS (Parathymosin)

ELK6450 1 plate of 96 wells
EUR 432
  • A monoclonal antibody specific to Parathymosin (PTMS) has been pre-coated onto a microplate. A competitive inhibition reaction is launched between biotin labeled Parathymosin (PTMS) and unlabeled Parathymosin (PTMS) (Standards or samples) with the pr
  • Show more
Description: A competitive Inhibition ELISA kit for detection of Parathymosin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Parathymosin (PTMS)

KTE70619-48T 48T
EUR 332
  • Parathymosin is a polypeptide similar in size and amino acid composition to prothymosin-alpha. It has a high content of dicarboxylic amino acids and a complete absence of aromatic and sulfur-containing amino acids. It has 101 amino acid residues as c
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Parathymosin (PTMS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Parathymosin (PTMS)

KTE70619-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Parathymosin is a polypeptide similar in size and amino acid composition to prothymosin-alpha. It has a high content of dicarboxylic amino acids and a complete absence of aromatic and sulfur-containing amino acids. It has 101 amino acid residues as c
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Parathymosin (PTMS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Parathymosin (PTMS)

KTE70619-96T 96T
EUR 539
  • Parathymosin is a polypeptide similar in size and amino acid composition to prothymosin-alpha. It has a high content of dicarboxylic amino acids and a complete absence of aromatic and sulfur-containing amino acids. It has 101 amino acid residues as c
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Parathymosin (PTMS) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Parathymosin (PTMS) CLIA Kit

20-abx490497
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Parathymosin (PTMS) Antibody

abx034304-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Parathymosin (PTMS) Antibody

abx034304-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Parathymosin (PTMS) Antibody

abx027033-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Parathymosin (PTMS) Antibody

abx027033-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Parathymosin (PTMS) Antibody

20-abx177914
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Parathymosin (PTMS) Antibody

20-abx177915
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Parathymosin (PTMS) Antibody

abx236925-100ug 100 ug
EUR 551
  • Shipped within 5-12 working days.

Parathymosin (PTMS) Protein

20-abx263385
  • EUR 1609.00
  • EUR 328.00
  • EUR 230.00
  • 100 ug
  • 10 ug
  • 2 µg
  • Shipped within 5-10 working days.

Bovine Parathymosin, PTMS ELISA KIT

ELI-22162b 96 Tests
EUR 928

Human Parathymosin, PTMS ELISA KIT

ELI-52418h 96 Tests
EUR 824

Rat Parathymosin, Ptms ELISA KIT

ELI-39105r 96 Tests
EUR 886

Human Parathymosin (PTMS) ELISA Kit

abx382557-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

PTMS ELISA KIT|Human

EF002163 96 Tests
EUR 689

Parathymosin Antibody

20-abx114332
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Parathymosin Antibody

abx037623-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

parathymosin Antibody

39326-100ul 100ul
EUR 390

Mouse PTMS shRNA Plasmid

20-abx976886
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PTMS Recombinant Protein (Mouse)

RP165581 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

PTMS siRNA

20-abx904362
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTMS siRNA

20-abx930333
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTMS siRNA

20-abx930334
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

PTMS antibody

70R-19634 50 ul
EUR 435
Description: Rabbit polyclonal PTMS antibody

PTMS Antibody

1-CSB-PA019008GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against PTMS. Recognizes PTMS from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

anti-PTMS

YF-PA14193 100 ug
EUR 403
Description: Rabbit polyclonal to PTMS

Ptms ORF Vector (Mouse) (pORF)

ORF055195 1.0 ug DNA
EUR 506

PTMS cloning plasmid

CSB-CL019008HU1-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 309
  • Sequence: atgcccaggagagagagtcctcaggaaaaggccccagaggacctgaaggagaagaaggagaaggtggaggagaaggcaagccggaaagagcgaaagaaagaagtggtggaggctccagtcccattggtggtgatggtgggcaaggcatgcagccagcctgaggctactccctctcc
  • Show more
Description: A cloning plasmid for the PTMS gene.

PTMS cloning plasmid

CSB-CL019008HU2-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 354
  • Sequence: atgaagcggatcccaaacggcagaagacagaaaatggggcatcggcgtgagcccctgccaacaggctggggttgggaggcctctctgggcctggaggtgggggtgggggcagccaagtccagccactcttcacctggctccctgctctgggccctgcaccagagctgccaccctct
  • Show more
Description: A cloning plasmid for the PTMS gene.

anti- PTMS antibody

FNab06925 100µg
EUR 585
  • Immunogen: parathymosin
  • Uniprot ID: P20962
  • Gene ID: 5763
  • Research Area: Metabolism
Description: Antibody raised against PTMS

Anti-PTMS antibody

PAab06925 100 ug
EUR 412

pCMV-SPORT6-PTMS

PVT12859 2 ug
EUR 391

Anti-PTMS (3H5)

YF-MA20404 100 ug
EUR 363
Description: Mouse monoclonal to PTMS

Anti-PTMS (2D3)

YF-MA10754 100 ug
EUR 363
Description: Mouse monoclonal to PTMS

Ptms sgRNA CRISPR Lentivector set (Mouse)

K4842301 3 x 1.0 ug
EUR 339

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Rat PTMS shRNA Plasmid

20-abx986861
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human PTMS shRNA Plasmid

20-abx953894
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

PTMS protein (His tag)

80R-3519 20 ug
EUR 327
Description: Purified recombinant PTMS protein (His tag)

PTMS Recombinant Protein (Human)

RP025150 100 ug Ask for price

PTMS Recombinant Protein (Human)

RP025153 100 ug Ask for price

PTMS Recombinant Protein (Rat)

RP222878 100 ug Ask for price

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

Ptms sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4842302 1.0 ug DNA
EUR 154

Ptms sgRNA CRISPR Lentivector (Mouse) (Target 2)

K4842303 1.0 ug DNA
EUR 154

Ptms sgRNA CRISPR Lentivector (Mouse) (Target 3)

K4842304 1.0 ug DNA
EUR 154

PTMS Protein Vector (Mouse) (pPB-C-His)

PV220778 500 ng
EUR 603

PTMS Protein Vector (Mouse) (pPB-N-His)

PV220779 500 ng
EUR 603

PTMS Protein Vector (Mouse) (pPM-C-HA)

PV220780 500 ng
EUR 603

PTMS Protein Vector (Mouse) (pPM-C-His)

PV220781 500 ng
EUR 603

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

PTMS ORF Vector (Human) (pORF)

ORF008384 1.0 ug DNA
EUR 95

PTMS ORF Vector (Human) (pORF)

ORF008385 1.0 ug DNA
EUR 95

PTMS Prothymosin Human Recombinant Protein

PROTP20962 Regular: 10ug
EUR 317
Description: PTMS Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 125 amino acids (1-102aa) and having a molecular mass of 13.9kDa.

Ptms ORF Vector (Rat) (pORF)

ORF074294 1.0 ug DNA
EUR 506

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

PTMS sgRNA CRISPR Lentivector set (Human)

K1753501 3 x 1.0 ug
EUR 339

Ptms sgRNA CRISPR Lentivector set (Rat)

K7116601 3 x 1.0 ug
EUR 339

vWF Acty. Kit

ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit

ABP-TOT-KIT 12 x 8 microwells
EUR 394

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)

CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Ptms sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K4842305 3 x 1.0 ug
EUR 376

PrecisionX Multiplex gRNA Cloning Kit

CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

PTMS sgRNA CRISPR Lentivector (Human) (Target 1)

K1753502 1.0 ug DNA
EUR 154

PTMS sgRNA CRISPR Lentivector (Human) (Target 2)

K1753503 1.0 ug DNA
EUR 154

PTMS sgRNA CRISPR Lentivector (Human) (Target 3)

K1753504 1.0 ug DNA
EUR 154

Ptms sgRNA CRISPR Lentivector (Rat) (Target 1)

K7116602 1.0 ug DNA
EUR 154

Ptms sgRNA CRISPR Lentivector (Rat) (Target 2)

K7116603 1.0 ug DNA
EUR 154

Ptms sgRNA CRISPR Lentivector (Rat) (Target 3)

K7116604 1.0 ug DNA
EUR 154

Recombinant Human PTMS Protein, His, E.coli-100ug

QP13207-0.1mg 100ug
EUR 1261

Recombinant Human PTMS Protein, His, E.coli-10ug

QP13207-10ug 10ug
EUR 201

Recombinant Human PTMS Protein, His, E.coli-2ug

QP13207-2ug 2ug
EUR 155

PTMS Protein Vector (Human) (pPB-C-His)

PV033533 500 ng
EUR 329

PTMS Protein Vector (Human) (pPB-N-His)

PV033534 500 ng
EUR 329

PTMS Protein Vector (Human) (pPM-C-HA)

PV033535 500 ng
EUR 329

PTMS Protein Vector (Human) (pPM-C-His)

PV033536 500 ng
EUR 329

PTMS Protein Vector (Human) (pPB-C-His)

PV033537 500 ng
EUR 329

PTMS Protein Vector (Human) (pPB-N-His)

PV033538 500 ng
EUR 329

PTMS Protein Vector (Human) (pPM-C-HA)

PV033539 500 ng
EUR 329

PTMS Protein Vector (Human) (pPM-C-His)

PV033540 500 ng
EUR 329

PTMS Protein Vector (Rat) (pPB-C-His)

PV297174 500 ng
EUR 603

PTMS Protein Vector (Rat) (pPB-N-His)

PV297175 500 ng
EUR 603

PTMS Protein Vector (Rat) (pPM-C-HA)

PV297176 500 ng
EUR 603

PTMS Protein Vector (Rat) (pPM-C-His)

PV297177 500 ng
EUR 603

Ptms 3'UTR GFP Stable Cell Line

TU167257 1.0 ml Ask for price

PTMS 3'UTR Luciferase Stable Cell Line

TU019180 1.0 ml
EUR 1394

Ptms 3'UTR Luciferase Stable Cell Line

TU117257 1.0 ml Ask for price

PTMS 3'UTR GFP Stable Cell Line

TU069180 1.0 ml
EUR 1394

Ptms 3'UTR GFP Stable Cell Line

TU267050 1.0 ml Ask for price

Ptms 3'UTR Luciferase Stable Cell Line

TU217050 1.0 ml Ask for price

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Ptms sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K4842306 1.0 ug DNA
EUR 167

Ptms sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K4842307 1.0 ug DNA
EUR 167

Ptms sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K4842308 1.0 ug DNA
EUR 167

PTMS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV626731 1.0 ug DNA
EUR 514

PTMS Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV626735 1.0 ug DNA
EUR 514

PTMS Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV626736 1.0 ug DNA
EUR 514

PTMS Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV)

LV713955 1.0 ug DNA
EUR 316

PTMS Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC)

LV713959 1.0 ug DNA
EUR 316

PTMS Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a)

LV713960 1.0 ug DNA
EUR 316

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

CLOuD9 Gene Expression Regulation Kit (includes 10 ug each of dCas9-PYL1 and dCas9-ABI1 lentivectors, and 100 ul of 0.5M Inducer Agent)

CASCL9-100A-KIT 1 Kit
EUR 1132
  • Category: Cas9

PTMS sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K1753505 3 x 1.0 ug
EUR 376

Ptms sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat)

K7116605 3 x 1.0 ug
EUR 376

PTMS sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K1753506 1.0 ug DNA
EUR 167

PTMS sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K1753507 1.0 ug DNA
EUR 167

PTMS sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K1753508 1.0 ug DNA
EUR 167

PTMS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV626732 1.0 ug DNA
EUR 514

PTMS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV626733 1.0 ug DNA
EUR 572

PTMS Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV626734 1.0 ug DNA
EUR 572

PTMS Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA)

LV713956 1.0 ug DNA
EUR 316

PTMS Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)

LV713957 1.0 ug DNA
EUR 374

PTMS Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)

LV713958 1.0 ug DNA
EUR 374

Ptms sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7116606 1.0 ug DNA
EUR 167

Ptms sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)

K7116607 1.0 ug DNA
EUR 167

Ptms sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3)

K7116608 1.0 ug DNA
EUR 167

AXYGEN® AXYPET® PRO STARTER KIT: 4 PIPETTORS, PLEXI STAND, SAMPLE TIPS

AP-STR-KIT-P 1/pk
EUR 721
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

KIT ELISA Kit (Mouse) (OKCD06004)

OKCD06004 96 Wells
EUR 779
Description: Description of target: The c-Kit proto-oncogene is the cellular homolog of the transforming gene of a feline retrovirus (v-Kit). The c-kit protein includes characteristics of a protein kinase transmembrane receptor. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.063ng/mL

Kit ELISA Kit (Mouse) (OKBB01105)

OKBB01105 96 Wells
EUR 505
Description: Description of target: SCFR(Mast/stem cell growth factor receptor), also known as proto-oncogene c-Kit or tyrosine-protein kinase Kit or CD117, is a protein that in humans is encoded by the KIT gene. KIT was first described as the cellular homolog of the feline sarcoma viral oncogene v-kit. The KIT gene is mapped on 4q12. Kit was expressed on the surface of germ cells up to the pachytene stage. Signaling from the KIT receptor tyrosine kinase is essential for primordial germ cell growth both in vivo and in vitro. Determination of the KIT effectors acting in primordial germ cells has been hampered by the lack of effective methods to manipulate easily gene expression in these cells.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: <10pg/ml

Cygb ELISA Kit| Mouse Cytoglobin ELISA Kit

EF014614 96 Tests
EUR 689

Dfnb31 ELISA Kit| Mouse Whirlin ELISA Kit

EF014640 96 Tests
EUR 689

Dmkn ELISA Kit| Mouse Dermokine ELISA Kit

EF014677 96 Tests
EUR 689

Dstn ELISA Kit| Mouse Destrin ELISA Kit

EF014680 96 Tests
EUR 689

Dpys ELISA Kit| Mouse Dihydropyrimidinase ELISA Kit

EF014695 96 Tests
EUR 689

Dixdc1 ELISA Kit| Mouse Dixin ELISA Kit

EF014715 96 Tests
EUR 689

Dbn1 ELISA Kit| Mouse Drebrin ELISA Kit

EF014734 96 Tests
EUR 689

Dym ELISA Kit| Mouse Dymeclin ELISA Kit

EF014745 96 Tests
EUR 689

Dysf ELISA Kit| Mouse Dysferlin ELISA Kit

EF014753 96 Tests
EUR 689

Dst ELISA Kit| Mouse Dystonin ELISA Kit

EF014755 96 Tests
EUR 689

Dtnbp1 ELISA Kit| Mouse Dysbindin ELISA Kit

EF014756 96 Tests
EUR 689

Dag1 ELISA Kit| Mouse Dystroglycan ELISA Kit

EF014757 96 Tests
EUR 689

Emb ELISA Kit| Mouse Embigin ELISA Kit

EF014774 96 Tests
EUR 689

Emd ELISA Kit| Mouse Emerin ELISA Kit

EF014776 96 Tests
EUR 689

Enam ELISA Kit| Mouse Enamelin ELISA Kit

EF014778 96 Tests
EUR 689

Emcn ELISA Kit| Mouse Endomucin ELISA Kit

EF014779 96 Tests
EUR 689

Enho ELISA Kit| Mouse Adropin ELISA Kit

EF014792 96 Tests
EUR 689

Evpl ELISA Kit| Mouse Envoplakin ELISA Kit

EF014798 96 Tests
EUR 689

Mouse PTMS(Parathymosin) ELISA Kit