Mouse RCN2(Reticulocalbin 2) ELISA Kit

Mouse RCN2(Reticulocalbin 2) ELISA Kit

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
RDR-RCN2-Mu-96Tests 96 Tests
EUR 774

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
RD-RCN2-Mu-48Tests 48 Tests
EUR 533

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
RD-RCN2-Mu-96Tests 96 Tests
EUR 740

Human Reticulocalbin 2 (RCN2) ELISA Kit
DLR-RCN2-Hu-48T 48T
EUR 517
  • Should the Human Reticulocalbin 2 (RCN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Reticulocalbin 2 (RCN2) in samples from tissue homogenates or other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
DLR-RCN2-Hu-96T 96T
EUR 673
  • Should the Human Reticulocalbin 2 (RCN2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Reticulocalbin 2 (RCN2) in samples from tissue homogenates or other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
RDR-RCN2-Hu-48Tests 48 Tests
EUR 544

Human Reticulocalbin 2 (RCN2) ELISA Kit
RDR-RCN2-Hu-96Tests 96 Tests
EUR 756

Human Reticulocalbin 2 (RCN2) ELISA Kit
RD-RCN2-Hu-48Tests 48 Tests
EUR 521

Human Reticulocalbin 2 (RCN2) ELISA Kit
RD-RCN2-Hu-96Tests 96 Tests
EUR 723

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
20-abx154617
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Reticulocalbin- 2, Rcn2 ELISA KIT
ELI-30109m 96 Tests
EUR 865

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Reticulocalbin 2 (RCN2) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) ELISA Kit
4-SEH244Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulocalbin 2 elisa. Alternative names of the recognized antigen: E6BP
  • ERC-55
  • ERC55
  • Endoplasmic Reticulum Calcium-Binding Protein 55kD
  • E6-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Reticulocalbin 2 (RCN2) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Mouse Reticulocalbin 2 (RCN2) Protein
20-abx650723
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

ELISA kit for Mouse RCN2 (Reticulocalbin 2)
ELK6497 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulocalbin 2 (RCN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticuloca
  • Show more
Description: A sandwich ELISA kit for detection of Reticulocalbin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)
KTE70515-48T 48T
EUR 332
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)
KTE70515-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Reticulocalbin-2 (RCN2)
KTE70515-96T 96T
EUR 539
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Reticulocalbin 2 (RCN2) CLIA Kit
20-abx495412
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Reticulocalbin 2 (RCN2)ELISA Kit
201-12-2940 96 tests
EUR 440
  • This Reticulocalbin 2 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
20-abx152954
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Reticulocalbin- 2, RCN2 ELISA KIT
ELI-18218h 96 Tests
EUR 824

Human Reticulocalbin 2(RCN2)ELISA Kit
QY-E01113 96T
EUR 361

Human Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
SEH244Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Reticulocalbin 2 (RCN2) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Reticulocalbin 2 (RCN2) in tissue homogenates, cell lysates and other biological fluids.

Human Reticulocalbin 2 (RCN2) ELISA Kit
4-SEH244Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulocalbin 2 elisa. Alternative names of the recognized antigen: E6BP
  • ERC-55
  • ERC55
  • Endoplasmic Reticulum Calcium-Binding Protein 55kD
  • E6-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Reticulocalbin 2 (RCN2) in samples from tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Reticulocalbin 2 (RCN2) Antibody
20-abx006517
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx178256
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-12 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx178257
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Reticulocalbin 2 (RCN2) Antibody
20-abx130981
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Reticulocalbin 2 (RCN2) Antibody
abx145146-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx141411
  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx174384
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Reticulocalbin 2 (RCN2) Antibody
20-abx321052
  • EUR 439.00
  • EUR 328.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
abx237212-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Reticulocalbin 2 (RCN2) Protein
20-abx262751
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Reticulocalbin 2 (RCN2) Antibody
20-abx001928
  • EUR 495.00
  • EUR 356.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Reticulocalbin 2 (RCN2)
4-RPH244Mu01
  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q8BP92
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 36.1kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Reticulocalbin 2 expressed in: E.coli

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse)
4-PAH244Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2)

ELISA kit for Human RCN2 (Reticulocalbin 2)
ELK4167 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Reticulocalbin 2 (RCN2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Reticuloca
  • Show more
Description: A sandwich ELISA kit for detection of Reticulocalbin 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)
KTE60815-48T 48T
EUR 332
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)
KTE60815-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Reticulocalbin-2 (RCN2)
KTE60815-96T 96T
EUR 539
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)
KTE100861-48T 48T
EUR 332
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)
KTE100861-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Reticulocalbin-2 (RCN2)
KTE100861-96T 96T
EUR 539
  • Reticulocalbin 2 is a calcium-binding protein located in the lumen of the ER, contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. The predicted 317-amino acid RCN2 protein contains an N-terminal signal
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Reticulocalbin-2 (RCN2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Human Reticulocalbin 2 (RCN2) CLIA Kit
20-abx495411
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Reticulocalbin 2 (RCN2) Protein
20-abx654946
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), APC
4-PAH244Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with APC.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), Biotinylated
4-PAH244Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with Biotin.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), Cy3
4-PAH244Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with Cy3.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), FITC
4-PAH244Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with FITC.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), HRP
4-PAH244Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with HRP.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), PE
4-PAH244Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with PE.

RCN2 Reticulocalbin 2 Human Recombinant Protein
PROTQ14257 Regular: 10ug
EUR 317
Description: RCN2 produced in E.Coli is a single, non-glycosylated polypeptide chain containing 313 amino acids (26-317 a.a.) and having a molecular mass of 36.8kDa (Molecular weight on SDS-PAGE will appear higher).;RCN2 is fused to a 21 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

Reticulocalbin 2 (RCN2) Polyclonal Antibody (Mouse), APC-Cy7
4-PAH244Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: RCN2 (Ser26~Ser301)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Reticulocalbin 2 (RCN2). This antibody is labeled with APC-Cy7.

Rcn2/ Rat Rcn2 ELISA Kit
ELI-42836r 96 Tests
EUR 886

RCN2 ELISA Kit (Mouse) (OKCD09039)
OKCD09039 96 Wells
EUR 1001
Description: Description of target: Not known. binds calcium (by similarity).;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.055ng/mL

RCN2 ELISA Kit (Mouse) (OKDD00748)
OKDD00748 96 Wells
EUR 988
Description: Description of target: Not known. binds calcium (by similarity).;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.054ng/mL

Mouse Reticulocalbin- 1, Rcn1 ELISA KIT
ELI-41186m 96 Tests
EUR 865

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

RCN2 ELISA KIT|Human
EF002392 96 Tests
EUR 689

Recombinant Human Reticulocalbin 2
7-06088 2µg Ask for price

Recombinant Human Reticulocalbin 2
7-06089 10µg Ask for price

Recombinant Human Reticulocalbin 2
7-06090 1mg Ask for price

Mouse RCN3 (Reticulocalbin-3) ELISA Kit (CUSTOM)
ELI-14162m 96 Tests
EUR 865

RCN2 ELISA Kit (Human) (OKCD01949)
OKCD01949 96 Wells
EUR 831
Description: Description of target: Not known. Binds calcium. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.122 ng/mL.

RCN2 ELISA Kit (Human) (OKCA02139)
OKCA02139 96 Wells
EUR 833
Description: Description of target: Not known. Binds calcium. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 3.9 pg/mL

Human Reticulocalbin 1 (RCN1)ELISA Kit
201-12-2939 96 tests
EUR 440
  • This Reticulocalbin 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 3 (RCN3)ELISA Kit
201-12-2941 96 tests
EUR 440
  • This Reticulocalbin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Reticulocalbin 1 (RCN1) ELISA Kit
abx253097-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human RCN1(Reticulocalbin 1) ELISA Kit
EH3705 96T
EUR 524.1
  • Detection range: 0.625-40 ng/ml
  • Uniprot ID: Q15293
  • Alias: RCN1(RCN)/Reticulocalbin-1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.375 ng/ml

Human Reticulocalbin- 1, RCN1 ELISA KIT
ELI-18302h 96 Tests
EUR 824

Human Reticulocalbin 3(RCN3)ELISA Kit
QY-E01112 96T
EUR 361

Human Reticulocalbin 1(RCN1)ELISA Kit
QY-E01114 96T
EUR 361

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

for Reticulocalbin 3 (RCN3)ELISA kit
SEH243Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of for Reticulocalbin 3 (RCN3) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of for Reticulocalbin 3 (RCN3) in Tissue homogenates, cell lysates and other biological fluids.

ELISA kit for Reticulocalbin 3 (RCN3)
4-SEH243Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Reticulocalbin 3 elisa. Alternative names of the recognized antigen: RLP49
  • EF-Hand Calcium Binding Domain
  • EF-hand calcium-binding protein RLP49
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Reticulocalbin 3 (RCN3) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rcn2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3538303 1.0 ug DNA
EUR 154

Mouse RCN2 shRNA Plasmid
20-abx973754
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RCN2 Recombinant Protein (Mouse)
RP167402 100 ug Ask for price

RCN2 antibody
70R-19834 50 ul
EUR 435
Description: Rabbit polyclonal RCN2 antibody

RCN2 Antibody
1-CSB-PA621768ESR1HU
  • EUR 222.00
  • EUR 335.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
Description: A polyclonal antibody against RCN2. Recognizes RCN2 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

RCN2 Antibody
DF12226 200ul
EUR 304
Description: RCN2 antibody detects endogenous levels of RCN2.

RCN2 Antibody
1-CSB-PA019513GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
Description: A polyclonal antibody against RCN2. Recognizes RCN2 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF

RCN2 siRNA
20-abx904517
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RCN2 siRNA
20-abx931168
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

RCN2 siRNA
20-abx931169
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

anti-RCN2
YF-PA14332 50 ug
EUR 363
Description: Mouse polyclonal to RCN2

anti-RCN2
YF-PA14333 100 ug
EUR 403
Description: Rabbit polyclonal to RCN2

AXYPET STARTER KIT 2 AP-10, AP-100 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-2 1/pk
EUR 367
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

ELISA kit for Human RCN1 (Reticulocalbin 1)
E-EL-H5569 1 plate of 96 wells
EUR 534
  • Gentaur's RCN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human RCN1. Standards or samples are added to the micro ELISA plate wells and combined with th
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human RCN1 (Reticulocalbin 1) in samples from Serum, Plasma, Cell supernatant

Bovine RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)
ELI-35646b 96 Tests
EUR 928

Human RCN3 (Reticulocalbin- 3) ELISA Kit (CUSTOM)
ELI-41187h 96 Tests
EUR 824

Rcn2 ORF Vector (Mouse) (pORF)
ORF055802 1.0 ug DNA
EUR 506

RCN2 Polyclonal Antibody
31313-100ul 100ul
EUR 252

RCN2 Polyclonal Antibody
31313-50ul 50ul
EUR 187

RCN2 Polyclonal Antibody
27706-100ul 100ul
EUR 252

RCN2 Polyclonal Antibody
27706-50ul 50ul
EUR 187

RCN2 Rabbit pAb
A12496-100ul 100 ul
EUR 308

RCN2 Rabbit pAb
A12496-200ul 200 ul
EUR 459

RCN2 Rabbit pAb
A12496-20ul 20 ul
EUR 183

RCN2 Rabbit pAb
A12496-50ul 50 ul
EUR 223

RCN2 Blocking Peptide
DF12226-BP 1mg
EUR 195

RCN2 cloning plasmid
CSB-CL621768HU-10ug 10ug
EUR 377
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 954
  • Sequence: atgcggctgggcccgaggaccgcggcgttggggctgctgctgctgtgcgccgccgcggccggcgccggcaaggccgaggagctgcactacccgctgggcgagcgccgcagcgactacgaccgcgaggcgctgctgggcgtccaggaagatgtggatgaatatgttaaactcggcca
  • Show more
Description: A cloning plasmid for the RCN2 gene.

RCN2 Rabbit pAb
A7721-100ul 100 ul
EUR 308

RCN2 Rabbit pAb
A7721-200ul 200 ul
EUR 459

RCN2 Rabbit pAb
A7721-20ul 20 ul
EUR 183

RCN2 Rabbit pAb
A7721-50ul 50 ul
EUR 223

anti- RCN2 antibody
FNab07212 100µg
EUR 548.75
  • Recommended dilution: WB: 1:500 - 1:2000
  • IHC: 1:50 - 1:200
  • Immunogen: reticulocalbin 2, EF-hand calcium binding domain
  • Uniprot ID: Q14257
  • Gene ID: 5955
  • Research Area: Signal Transduction
Description: Antibody raised against RCN2

Anti-RCN2 antibody
PAab07212 100 ug
EUR 386

Anti-RCN2 antibody
STJ11100819 100 µl
EUR 413
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 antibody
STJ114370 100 µl
EUR 277
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 antibody
STJ110032 100 µl
EUR 277
Description: The protein encoded by this gene is a calcium-binding protein located in the lumen of the ER. The protein contains six conserved regions with similarity to a high affinity Ca(+2)-binding motif, the EF-hand. This gene maps to the same region as type 4 Bardet-Biedl syndrome, suggesting a possible causative role for this gene in the disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.

Anti-RCN2 (2B12)
YF-MA15141 200 ul
EUR 363
Description: Mouse monoclonal to RCN2

Anti-RCN2 (1A9)
YF-MA15142 100 ug
EUR 363
Description: Mouse monoclonal to RCN2

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Recombinant Human Reticulocalbin 1
7-06085 2µg Ask for price

Recombinant Human Reticulocalbin 1
7-06086 10µg Ask for price

Recombinant Human Reticulocalbin 1
7-06087 1mg Ask for price

Human Reticulocalbin-1 (RCN1)
1-CSB-YP618980HU
  • EUR 430.00
  • EUR 234.00
  • EUR 1508.00
  • EUR 642.00
  • EUR 1009.00
  • EUR 291.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 37.7 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Reticulocalbin-1(RCN1),partial expressed in Yeast

Reticulocalbin 1 (RCN1) Antibody
20-abx126465
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Antibody
abx032616-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Antibody
abx032616-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Reticulocalbin 3 (RCN3) Protein
20-abx260866
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Reticulocalbin 1 (RCN1) Protein
20-abx262856
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

Rcn2 sgRNA CRISPR Lentivector set (Mouse)
K3538301 3 x 1.0 ug
EUR 339

Rcn2 sgRNA CRISPR Lentivector (Rat) (Target 2)
K6916003 1.0 ug DNA
EUR 154

RCN2 sgRNA CRISPR Lentivector (Human) (Target 2)
K1803903 1.0 ug DNA
EUR 154

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266

Reticulocalbin 2, Ef-Hand Calcium Binding Domain Antibody
20-abx115134
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

RCN2 protein (His tag)
80R-1754 50 ug
EUR 397
Description: Purified recombinant Human RCN2 protein

Rat RCN2 shRNA Plasmid
20-abx985358
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RCN2 Polyclonal Conjugated Antibody
C27706 100ul
EUR 397

RCN2 Polyclonal Conjugated Antibody
C31313 100ul
EUR 397

Human RCN2 shRNA Plasmid
20-abx954031
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

RCN2 Recombinant Protein (Human)
RP026080 100 ug Ask for price

RCN2 Recombinant Protein (Rat)
RP223952 100 ug Ask for price

Rcn2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3538302 1.0 ug DNA
EUR 154

Rcn2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3538304 1.0 ug DNA
EUR 154

RCN2 Protein Vector (Mouse) (pPB-C-His)
PV223206 500 ng
EUR 603

RCN2 Protein Vector (Mouse) (pPB-N-His)
PV223207 500 ng
EUR 603

RCN2 Protein Vector (Mouse) (pPM-C-HA)
PV223208 500 ng
EUR 603

RCN2 Protein Vector (Mouse) (pPM-C-His)
PV223209 500 ng
EUR 603

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Mouse FGF-2 Recombinant Protein
R00121-2 5ug/vial
EUR 259
Description: FGF basic (FGF2) is a multipotential fibroblast growth factor that stimulates and supports proliferation, migration and differentiation. Mouse FGF basic (FGF-2) Recombinant Protein is purified FGF basic (FGF-2) produced in yeast.

Human Reticulocalbin 3 (RCN3) Antibody
35620-05111 150 ug
EUR 261

Rcn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3538307 1.0 ug DNA
EUR 167

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Dr. P Kit-Solution 2
K2021010-2 6 ml
EUR 120
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation.

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Anti-Adiponectin Receptor 2 (mouse) Antibody
A02218-2 200ug
EUR 498
Description: Goat Polyclonal Adiponectin Receptor 2 (mouse) Antibody. Validated in IF, IHC and tested in Mouse.

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector
CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]
CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

Polyclonal RCAN2 / RCN2 Antibody (Internal)
APR13081G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human RCAN2 / RCN2 (Internal). This antibody is tested and proven to work in the following applications:

[KO Validated] RCN2 Rabbit pAb
A19943-100ul 100 ul
EUR 410

[KO Validated] RCN2 Rabbit pAb
A19943-200ul 200 ul
EUR 571

[KO Validated] RCN2 Rabbit pAb
A19943-20ul 20 ul
EUR 221

[KO Validated] RCN2 Rabbit pAb
A19943-50ul 50 ul
EUR 287

Rcn2 ORF Vector (Rat) (pORF)
ORF074652 1.0 ug DNA
EUR 506

RCN2 ORF Vector (Human) (pORF)
ORF008694 1.0 ug DNA
EUR 95

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Mouse Pancreas PrimaCell 2: Pancreatic Epithelial Cells
2-82102 1 Kit Ask for price

RCN1 Reticulocalbin 1 Human Recombinant Protein
PROTQ15293 Regular: 10ug
EUR 317
Description: RCN1 Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 341 amino acids (30-331 a.a.) and having a molecular mass of 40.4kDa (real molecular weight on SDS-PAGE will be shift up). The RCN1 is fused to 39 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

RCN3 Reticulocalbin 3 Human Recombinant Protein
PROTQ96D15 Regular: 20ug
EUR 317
Description: RCN3 Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 333 amino acids (21-328 a.a) and having a molecular mass of 37.9kDa.;RCN3 is fused to a 25 amino acid His-tag at N-terminus & purified by proprietary chromatographic techniques.

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Aflatoxin Total ELISA Kit
DEIA051-2 96T
EUR 741
Description: This kit can be used for qualitative and quantitative analysis of aflatoxin total in edible oil, peanut, cereal etc.

LH (Luteinizing Hormone) ELISA test
2 96T/Box Ask for price
  • Area of application: Hormone testing
Description: ELISA based test for quantitative detection of LH (Luteinizing Hormone)

Rcn2 sgRNA CRISPR Lentivector set (Rat)
K6916001 3 x 1.0 ug
EUR 339

RCN2 sgRNA CRISPR Lentivector set (Human)
K1803901 3 x 1.0 ug
EUR 339

vWF Acty. Kit
ABP-ACT-KIT 12 x 8 microwells
EUR 428

vWF Ant. Kit
ABP-TOT-KIT 12 x 8 microwells
EUR 394

Bovine Haptoglobin AssayMax ELISA Kit
EBH2003-2 96 Well Plate
EUR 417

Human Reticulocalbin 3 (RCN3) Antibody (Biotin Conjugate)
35620-05121 150 ug
EUR 369

Recombinant Human Reticulocalbin-3/RCN3 (C-6His)
CA44-10ug 10ug
EUR 156
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM DTT,10%Glycerol,pH7.4.

Recombinant Human Reticulocalbin-3/RCN3 (C-6His)
CA44-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM DTT,10%Glycerol,pH7.4.

Recombinant Human Reticulocalbin-3/RCN3 (C-6His)
CA44-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM DTT,10%Glycerol,pH7.4.

Recombinant Human Reticulocalbin-3/RCN3 (C-6His)
CA44-50ug 50ug
EUR 369
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl,150mM NaCl,1mM DTT,10%Glycerol,pH7.4.

2-Propyl-β-D-glucuronide, 2 mg
0904-2 2 mg
EUR 162

hspCas9 AAVS1 Safe Harbor Knock-in Donor (AAVS1-SA-puro-EF1-hspCas9)
CAS620A-KIT 1 kit
EUR 2152
  • Category: Cas9
Description: Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector), CAS640PR-1 (Junction PCR Primer Mix to confirm Cas9 integration site), and CAS9-PR-1 (PCR primers to confirm Cas9 expression)

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Human Fibrinogen (FBG) AssayMax ELISA Kit
EF1040-2 96 Well Plate
EUR 396

PrecisionX Multiplex gRNA Cloning Kit
CAS9-GRNA-KIT 10 rxn
EUR 445
  • Category: Cas9

Rcn2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2)
K6916007 1.0 ug DNA
EUR 167

RCN2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K1803907 1.0 ug DNA
EUR 167

Custom Anti-Peptide antibodies, 2 peptides (upto 20-aa; synthesis, 2 conjugation, 2 rabbits, 2 ELISA)
ABPEP-20-2 1
EUR 2356

Custom Anti-Peptide antibodies 2 peptides (upto 20-aa, synthesis, 2 conjugation, 2 rabbits, 2 ELISA & 2 Aff. Purif.)
ABPEP-20A-2 1
EUR 3806

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

Rcn2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3538305 3 x 1.0 ug
EUR 376

IL-2 Interleukin-2 Human Recombinant Protein, His Tag
PROTP60568-2 Regular: 10ug
EUR 317
Description: Interleukin-2 Human Recombinant produced in E.Coli is a single, non-glycosylated, Polypeptide chain containing 133 amino acids fragment (21-153) having a molecular weight of 20kDa and fused with a 4.5kDa amino-terminal hexahistidine tag. _x000D_ The IL-2 His is purified by proprietary chromatographic techniques._x000D_

Rcn2 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6916002 1.0 ug DNA
EUR 154

Rcn2 sgRNA CRISPR Lentivector (Rat) (Target 3)
K6916004 1.0 ug DNA
EUR 154

RCN2 sgRNA CRISPR Lentivector (Human) (Target 1)
K1803902 1.0 ug DNA
EUR 154

RCN2 sgRNA CRISPR Lentivector (Human) (Target 3)
K1803904 1.0 ug DNA
EUR 154

RCN2 Protein Vector (Rat) (pPB-C-His)
PV298606 500 ng
EUR 603

RCN2 Protein Vector (Rat) (pPB-N-His)
PV298607 500 ng
EUR 603

RCN2 Protein Vector (Rat) (pPM-C-HA)
PV298608 500 ng
EUR 603

RCN2 Protein Vector (Rat) (pPM-C-His)
PV298609 500 ng
EUR 603

RCN2 Protein Vector (Human) (pPB-C-His)
PV034773 500 ng
EUR 329

RCN2 Protein Vector (Human) (pPB-N-His)
PV034774 500 ng
EUR 329

RCN2 Protein Vector (Human) (pPM-C-HA)
PV034775 500 ng
EUR 329

RCN2 Protein Vector (Human) (pPM-C-His)
PV034776 500 ng
EUR 329

Recombinant Human RCN2 Protein, His, E.coli-10ug
QP13289-10ug 10ug
EUR 201

Recombinant Human RCN2 Protein, His, E.coli-1mg
QP13289-1mg 1mg
EUR 5251

Recombinant Human RCN2 Protein, His, E.coli-2ug
QP13289-2ug 2ug
EUR 155

Rcn2 3'UTR Luciferase Stable Cell Line
TU117671 1.0 ml Ask for price

Rcn2 3'UTR GFP Stable Cell Line
TU167671 1.0 ml Ask for price

Rcn2 3'UTR Luciferase Stable Cell Line
TU217431 1.0 ml Ask for price

Rcn2 3'UTR GFP Stable Cell Line
TU267431 1.0 ml Ask for price

RCN2 3'UTR GFP Stable Cell Line
TU069703 1.0 ml
EUR 1521

RCN2 3'UTR Luciferase Stable Cell Line
TU019703 1.0 ml
EUR 1521

BMP-2 Bone Morphogenetic Protein-2 Human Recombinant Protein, Monomer
PROTP12643-2 Regular: 20ug
EUR 317
Description: Bone Morphogenetic Protein-2 Human Recombinant produced in E.Coli is a monomeric, non-glycosylated, Polypeptide chain containing 115 amino acids (283-396) and having a molecular mass of 13009 Dalton. ;The BMP-2 is purified by proprietary chromatographic techniques.

Mouse RCN2(Reticulocalbin 2) ELISA Kit