Mouse REPIN1(Replication Initiator 1) ELISA Kit

Mouse REPIN1(Replication Initiator 1) ELISA Kit

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RDR-REPIN1-Mu-48Tests 48 Tests
EUR 557

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
RDR-REPIN1-Mu-96Tests 96 Tests
EUR 774

Human Replication Initiator 1 (REPIN1) ELISA Kit
DLR-REPIN1-Hu-48T 48T
EUR 517
  • Should the Human Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Initiator 1 (REPIN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
DLR-REPIN1-Hu-96T 96T
EUR 673
  • Should the Human Replication Initiator 1 (REPIN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Initiator 1 (REPIN1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
RD-REPIN1-Hu-48Tests 48 Tests
EUR 521

Human Replication Initiator 1 (REPIN1) ELISA Kit
RD-REPIN1-Hu-96Tests 96 Tests
EUR 723

Human Replication Initiator 1 (REPIN1) ELISA Kit
RDR-REPIN1-Hu-48Tests 48 Tests
EUR 544

Human Replication Initiator 1 (REPIN1) ELISA Kit
RDR-REPIN1-Hu-96Tests 96 Tests
EUR 756

Mouse Replication initiator 1, Repin1 ELISA KIT
ELI-44355m 96 Tests
EUR 865

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
20-abx154614
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Mouse Replication Initiator 1(REPIN1)ELISA Kit
QY-E21317 96T
EUR 361

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Mouse Replication Initiator 1 (REPIN1) ELISA Kit
4-SEG516Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4
  • RIP60
  • ZNF464
  • Zfp464
  • Replication Initiation Region Protein(60kD)
  • Zinc Finger Protein 464
  • 60 kDa origin-specific DNA-binding protein
  • ATT-binding protei
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Replication Initiator 1 (REPIN1) Antibody
20-abx129189
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Replication Initiator 1 (REPIN1) Antibody
20-abx129904
  • EUR 314.00
  • EUR 133.00
  • EUR 829.00
  • EUR 439.00
  • EUR 272.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Replication Initiator 1 (REPIN1) Antibody
20-abx174377
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Replication Initiator 1 (REPIN1) Antibody
20-abx178249
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Replication Initiator 1 (REPIN1)
4-RPG516Hu01
  • EUR 485.28
  • EUR 233.00
  • EUR 1544.80
  • EUR 581.60
  • EUR 1063.20
  • EUR 388.00
  • EUR 3712.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9BWE0
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 33.4kDa
  • Isoelectric Point: Inquire
Description: Recombinant Human Replication Initiator 1 expressed in: E.coli

Recombinant Replication Initiator 1 (REPIN1)
4-RPG516Mu01
  • EUR 501.41
  • EUR 237.00
  • EUR 1605.28
  • EUR 601.76
  • EUR 1103.52
  • EUR 398.00
  • EUR 3863.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q5U4E2
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 34.6kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Replication Initiator 1 expressed in: E.coli

Mouse Replication Initiator 1 (REPIN1) Protein
20-abx168411
  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Mouse Replication Initiator 1 (REPIN1) CLIA Kit
20-abx495230
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human REPIN1(Replication Initiator 1) ELISA Kit
EH3712 96T
EUR 524.1
  • Detection range: 0.313-20 ng/ml
  • Uniprot ID: Q9BWE0
  • Alias: REPIN1/Zinc finger protein 464/DHFR oribeta-binding protein RIP60/ATT-binding protein/60 kDa origin-specific DNA-binding protein/60 kDa replication initiation region protein/RIP60/ZNF464
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.188 ng/ml

Human Replication initiator 1, REPIN1 ELISA KIT
ELI-14616h 96 Tests
EUR 824

Bovine Replication initiator 1, REPIN1 ELISA KIT
ELI-52607b 96 Tests
EUR 928

Human Replication Initiator 1 (REPIN1) ELISA Kit
20-abx152951
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Replication Initiator 1 (REPIN1) ELISA Kit
abx253102-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Rat Replication Initiator 1 (REPIN1) ELISA Kit
abx391903-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Replication Initiator 1 (REPIN1)ELISA Kit
201-12-2402 96 tests
EUR 440
  • This Replication Initiator 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Replication Initiator 1(REPIN1)ELISA Kit
QY-E03529 96T
EUR 361

Rat Replication Initiator 1(REPIN1)ELISA Kit
QY-E10499 96T
EUR 361

Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
SEG516Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Initiator 1 (REPIN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Initiator 1 (REPIN1) in Tissue homogenates and other biological fluids.

Human Replication Initiator 1 (REPIN1) ELISA Kit
4-SEG516Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Initiator 1 elisa. Alternative names of the recognized antigen: AP4
  • RIP60
  • ZNF464
  • Zfp464
  • Replication Initiation Region Protein(60kD)
  • Zinc Finger Protein 464
  • 60 kDa origin-specific DNA-binding protein
  • ATT-binding protei
  • Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Initiator 1 (REPIN1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse REPIN1 (Replication Initiator 1)
ELK6478 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R
  • Show more
Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Replication initiator 1 (REPIN1)
KTE70507-48T 48T
EUR 332
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Replication initiator 1 (REPIN1)
KTE70507-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Replication initiator 1 (REPIN1)
KTE70507-96T 96T
EUR 539
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Repin1 ELISA Kit| Mouse Replication initiator 1 ELISA Kit
EF016079 96 Tests
EUR 689

Human Replication Initiator 1 (REPIN1) Protein
20-abx168192
  • EUR 676.00
  • EUR 286.00
  • EUR 2082.00
  • EUR 801.00
  • EUR 481.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse)
4-PAG516Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1)

Human Replication Initiator 1 (REPIN1) CLIA Kit
abx195148-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Replication Initiator 1 (REPIN1) CLIA Kit
20-abx495229
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Human REPIN1 (Replication Initiator 1)
E-EL-H1760 1 plate of 96 wells
EUR 534
  • Gentaur's REPIN1 ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1. Standards or samples are added to the micro ELISA plate wells and combined wit
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human REPIN1 (Replication Initiator 1)
ELK3776 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Replication Initiator 1 (REPIN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to R
  • Show more
Description: A sandwich ELISA kit for detection of Replication Initiator 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Replication initiator 1 (REPIN1)
KTE60806-48T 48T
EUR 332
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Replication initiator 1 (REPIN1)
KTE60806-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Replication initiator 1 (REPIN1)
KTE60806-96T 96T
EUR 539
  • Replication initiator 1 is a protein encoded by the REPIN1 gene. Homodimers of RIP60 (replication initiation-region protein 60 kDA) purified from nuclear extract bind two ATT-rich sites in oribeta and foster the formation of a twisted 720 bp DNA loop
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Replication initiator 1 (REPIN1) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Repin1 ELISA Kit| Rat Replication initiator 1 ELISA Kit
EF019263 96 Tests
EUR 689

REPIN1 ELISA Kit| Bovine Replication initiator 1 ELISA Kit
EF011851 96 Tests
EUR 689

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC
4-PAG516Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Biotinylated
4-PAG516Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), Cy3
4-PAG516Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), FITC
4-PAG516Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with FITC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), HRP
4-PAG516Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with HRP.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), PE
4-PAG516Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with PE.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human)
4-PAG516Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1)

CLIA kit for Human REPIN1 (Replication Initiator 1)
E-CL-H1102 1 plate of 96 wells
EUR 584
  • Gentaur's REPIN1 CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human REPIN1 . Standards or samples are added to the micro CLIA plate wells and combined with
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human REPIN1 (Replication Initiator 1) in samples from Serum, Plasma, Cell supernatant

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAG516Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (Pro30~Pro298)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC
4-PAG516Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Biotinylated
4-PAG516Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Biotin.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), Cy3
4-PAG516Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with Cy3.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), FITC
4-PAG516Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with FITC.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), HRP
4-PAG516Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with HRP.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), PE
4-PAG516Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with PE.

Replication Initiator 1 (REPIN1) Polyclonal Antibody (Human), APC-Cy7
4-PAG516Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: REPIN1 (His57~His314)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Replication Initiator 1 (REPIN1). This antibody is labeled with APC-Cy7.

Recombinant human Replication initiator 1
P2526 100ug Ask for price
  • Uniprot ID: Q9BWE0
  • Reconstitution: Metal affinity chromatography on Fn Super Capacity Column (Nickel)
Description: Recombinant protein for human Replication initiator 1

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1 1
EUR 202

Repin1/ Rat Repin1 ELISA Kit
ELI-19261r 96 Tests
EUR 886

REPIN1 ELISA Kit (Mouse) (OKCD01001)
OKCD01001 96 Wells
EUR 857
Description: Description of target: Sequence-specific double-stranded DNA-binding protein required for initiation of chromosomal DNA replication. Binds on 5'-ATT-3' reiterated sequences downstream of the origin of bidirectional replication (OBR) and a second, homologous ATT sequence of opposite orientation situated within the OBR zone. Facilitates DNA bending (By similarity).By similarity ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.135 ng/mL

REPIN1 ELISA KIT|Human
EF007143 96 Tests
EUR 689

REPIN1 ELISA Kit (Human) (OKCD01920)
OKCD01920 96 Wells
EUR 831
Description: Description of target: Sequence-specific double-stranded DNA-binding protein required for initiation of chromosomal DNA replication. Binds on 5'-ATT-3' reiterated sequences downstream of the origin of bidirectional replication (OBR) and a second, homologous ATT sequence of opposite orientation situated within the OBR zone. Facilitates DNA bending. ;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.129 ng/mL

Mouse Replication factor C subunit 1, Rfc1 ELISA KIT
ELI-14393m 96 Tests
EUR 865

Mouse REPIN1 shRNA Plasmid
20-abx975121
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

REPIN1 Recombinant Protein (Mouse)
RP167606 100 ug Ask for price

REPIN1 Recombinant Protein (Mouse)
RP167609 100 ug Ask for price

REPIN1 Recombinant Protein (Mouse)
RP167612 100 ug Ask for price

REPIN1 Recombinant Protein (Mouse)
RP167615 100 ug Ask for price

REPIN1 Recombinant Protein (Mouse)
RP167618 100 ug Ask for price

REPIN1 Recombinant Protein (Mouse)
RP167621 100 ug Ask for price

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

REPIN1 siRNA
20-abx904532
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

REPIN1 siRNA
20-abx931266
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

REPIN1 siRNA
20-abx931267
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

pOTB7-REPIN1
PVT18357 2 ug
EUR 231

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Repin1 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3922202 1.0 ug DNA
EUR 154

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Repin1 ORF Vector (Mouse) (pORF)
ORF055870 1.0 ug DNA
EUR 506

Repin1 ORF Vector (Mouse) (pORF)
ORF055871 1.0 ug DNA
EUR 506

Repin1 ORF Vector (Mouse) (pORF)
ORF055872 1.0 ug DNA
EUR 506

Repin1 ORF Vector (Mouse) (pORF)
ORF055873 1.0 ug DNA
EUR 506

Repin1 ORF Vector (Mouse) (pORF)
ORF055874 1.0 ug DNA
EUR 506

Repin1 ORF Vector (Mouse) (pORF)
ORF055875 1.0 ug DNA
EUR 506

Mouse DNA Replication Factor CDT1 (CDT1) ELISA Kit
abx516727-96tests 96 tests
EUR 739
  • Shipped within 5-12 working days.

Mouse DNA replication licensing factor MCM3 ELISA kit
E03D0531-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse DNA replication licensing factor MCM3 ELISA kit
E03D0531-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse DNA replication licensing factor MCM3 ELISA kit
E03D0531-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse DNA replication licensing factor MCM3 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse DNA replication factor Cdt1, Cdt1 ELISA KIT
ELI-34095m 96 Tests
EUR 865

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

Cdt1 ELISA Kit| Mouse DNA replication factor Cdt1 ELISA Kit
EF014493 96 Tests
EUR 689

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

REPIN1 cloning plasmid
CSB-CL019564HU1-10ug 10ug
EUR 587
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1704
  • Sequence: atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgct
  • Show more
Description: A cloning plasmid for the REPIN1 gene.

REPIN1 cloning plasmid
CSB-CL019564HU2-10ug 10ug
EUR 587
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1704
  • Sequence: atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgct
  • Show more
Description: A cloning plasmid for the REPIN1 gene.

REPIN1 Rabbit pAb
A18451-100ul 100 ul
EUR 308

REPIN1 Rabbit pAb
A18451-200ul 200 ul
EUR 459

REPIN1 Rabbit pAb
A18451-20ul 20 ul
EUR 183

REPIN1 Rabbit pAb
A18451-50ul 50 ul
EUR 223

pOTB7-REPIN1-2
PVT18946 2 ug
EUR 231

Anti-REPIN1 antibody
STJ11100405 100 µl
EUR 277

Replication Protein A2 (RPA2) ELISA Kit
abx595526-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Human Replication factor C subunit 1, RFC1 ELISA KIT
ELI-21926h 96 Tests
EUR 824

Human Replication Factor C Subunit 1 (RFC1) ELISA Kit
abx257525-96tests 96 tests
EUR 637
  • Shipped within 5-12 working days.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Mouse Replication factor C subunit 2(RFC2) ELISA kit
E03R0404-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Replication factor C subunit 2(RFC2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Replication factor C subunit 2(RFC2) ELISA kit
E03R0404-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Replication factor C subunit 2(RFC2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Replication factor C subunit 2(RFC2) ELISA kit
E03R0404-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse Replication factor C subunit 2(RFC2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse DNA replication licensing factor MCM3, Mcm3 ELISA KIT
ELI-22749m 96 Tests
EUR 865

Mouse DNA replication licensing factor MCM2, Mcm2 ELISA KIT
ELI-05737m 96 Tests
EUR 865

Mouse DNA replication licensing factor MCM7, Mcm7 ELISA KIT
ELI-15742m 96 Tests
EUR 865

Mouse DNA replication licensing factor MCM6, Mcm6 ELISA KIT
ELI-16344m 96 Tests
EUR 865

Mouse Replication factor C subunit 2, Rfc2 ELISA KIT
ELI-35655m 96 Tests
EUR 865

Mouse Replication factor C subunit 3, Rfc3 ELISA KIT
ELI-35656m 96 Tests
EUR 865

Mouse Replication factor C subunit 5, Rfc5 ELISA KIT
ELI-35657m 96 Tests
EUR 865

Mouse DNA replication licensing factor MCM4, Mcm4 ELISA KIT
ELI-37314m 96 Tests
EUR 865

Mouse DNA replication licensing factor MCM5, Mcm5 ELISA KIT
ELI-46427m 96 Tests
EUR 865

Mouse Replication factor C subunit 4, Rfc4 ELISA KIT
ELI-41193m 96 Tests
EUR 865

Mouse DNA replication licensing factor MCM9, Mcm9 ELISA KIT
ELI-48197m 96 Tests
EUR 865

Mouse DNA replication licensing factor MCM8, Mcm8 ELISA KIT
ELI-38435m 96 Tests
EUR 865

Repin1 sgRNA CRISPR Lentivector set (Mouse)
K3922201 3 x 1.0 ug
EUR 339

Column Packing Kit
PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

PCR Mycoplasma Detection Kit
M034-Kit Kit
EUR 266

Mouse Interleukin-1 beta (IL-1 beta) AssayMax ELISA Kit
EMI2200-1 96 Well Plate
EUR 477

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Pig Replication Protein A1 (RPA1) ELISA Kit
abx360874-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Replication Protein A1 (RPA1) ELISA Kit
abx363576-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Replication Protein A1 (RPA1) ELISA Kit
abx573009-96tests 96 tests
EUR 786
  • Shipped within 5-12 working days.

Rat Replication Protein A1 (RPA1) ELISA Kit
20-abx156054
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Replication Protein A1 (RPA1) ELISA Kit
20-abx152981
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Replication Protein A2 (RPA2) ELISA Kit
abx382883-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Replication Protein A3 (RPA3) ELISA Kit
abx382884-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Monkey Replication Protein A1 (RPA1) ELISA Kit
abx358961-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Replication Protein A1 (RPA1) ELISA Kit
abx355854-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Replication Protein A1 (RPA1) ELISA Kit
DLR-RPA1-Hu-48T 48T
EUR 517
  • Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
DLR-RPA1-Hu-96T 96T
EUR 673
  • Should the Human Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Replication Protein A1 (RPA1) in samples from tissue homogenates or other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit
DLR-RPA1-Ra-48T 48T
EUR 549
  • Should the Rat Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Replication Protein A1 (RPA1) in samples from tissue homogenates, cell lysates or other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit
DLR-RPA1-Ra-96T 96T
EUR 718
  • Should the Rat Replication Protein A1 (RPA1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Rat Replication Protein A1 (RPA1) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Hu-48Tests 48 Tests
EUR 521

Human Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Hu-96Tests 96 Tests
EUR 723

Rat Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Ra-48Tests 48 Tests
EUR 557

Rat Replication Protein A1 (RPA1) ELISA Kit
RD-RPA1-Ra-96Tests 96 Tests
EUR 775

Human Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Hu-48Tests 48 Tests
EUR 544

Human Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Hu-96Tests 96 Tests
EUR 756

Rat Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Ra-48Tests 48 Tests
EUR 583

Rat Replication Protein A1 (RPA1) ELISA Kit
RDR-RPA1-Ra-96Tests 96 Tests
EUR 811

Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
SEH217Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Replication Protein A1 (RPA1) in Tissue homogenates and other biological fluids.

Human Replication Protein A1 (RPA1) ELISA Kit
4-SEH217Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB
  • REPA1
  • RF-A
  • RP-A
  • RPA70
  • Replication protein A 70 kDa DNA-binding subunit
  • Single-stranded DNA-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Replication Protein A1 (RPA1) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Rat Replication Protein A1 (RPA1) ELISA Kit
SEH217Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit
SEH217Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit
SEH217Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit
SEH217Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Replication Protein A1 (RPA1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Replication Protein A1 (RPA1) in Tissue homogenates, cell lysates and other biological fluids.

Rat Replication Protein A1 (RPA1) ELISA Kit
4-SEH217Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Replication Protein A1 elisa. Alternative names of the recognized antigen: HSSB
  • REPA1
  • RF-A
  • RP-A
  • RPA70
  • Replication protein A 70 kDa DNA-binding subunit
  • Single-stranded DNA-binding protein
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Replication Protein A1 (RPA1) in samples from Tissue homogenates, cell lysates and other biological fluids. with no significant corss-reactivity with analogues from other species.

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)
GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Human REPIN1 shRNA Plasmid
20-abx959235
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Rat REPIN1 shRNA Plasmid
20-abx990772
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

REPIN1 Recombinant Protein (Human)
RP026188 100 ug Ask for price

REPIN1 Recombinant Protein (Human)
RP026191 100 ug Ask for price

REPIN1 Recombinant Protein (Rat)
RP224087 100 ug Ask for price

REPIN1 sgRNA CRISPR Lentivector (Human) (Target 1)
K1809002 1.0 ug DNA
EUR 154

Repin1 sgRNA CRISPR Lentivector (Rat) (Target 1)
K6690502 1.0 ug DNA
EUR 154

Mouse Insulin-like Growth Factor 1 (IGF-1) AssayMax ELISA Kit
EMI1001-1 96 Well Plate
EUR 477

Mouse DNA replication complex GINS protein SLD5, Gins4 ELISA KIT
ELI-19179m 96 Tests
EUR 865

Mouse Replication protein A 14 kDa subunit, Rpa3 ELISA KIT
ELI-21925m 96 Tests
EUR 865

Mouse DNA replication complex GINS protein PSF1, Gins1 ELISA KIT
ELI-35887m 96 Tests
EUR 865

Mouse DNA replication complex GINS protein PSF2, Gins2 ELISA KIT
ELI-35888m 96 Tests
EUR 865

Mouse DNA replication complex GINS protein PSF3, Gins3 ELISA KIT
ELI-30603m 96 Tests
EUR 865

Mouse Replication protein A 32 kDa subunit, Rpa2 ELISA KIT
ELI-38913m 96 Tests
EUR 865

ELISA kit for Mouse DNA replication licensing factor MCM2 (MCM2)
KTE71097-48T 48T
EUR 332
  • DNA replication licensing factor MCM2 is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key compon
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse DNA replication licensing factor MCM2 (MCM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse DNA replication licensing factor MCM2 (MCM2)
KTE71097-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DNA replication licensing factor MCM2 is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key compon
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse DNA replication licensing factor MCM2 (MCM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse DNA replication licensing factor MCM2 (MCM2)
KTE71097-96T 96T
EUR 539
  • DNA replication licensing factor MCM2 is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key compon
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse DNA replication licensing factor MCM2 (MCM2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

Repin1 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3922203 1.0 ug DNA
EUR 154

Repin1 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3922204 1.0 ug DNA
EUR 154

REPIN1 Protein Vector (Mouse) (pPB-C-His)
PV223478 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPB-N-His)
PV223479 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPM-C-HA)
PV223480 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPM-C-His)
PV223481 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPB-C-His)
PV223482 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPB-N-His)
PV223483 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPM-C-HA)
PV223484 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPM-C-His)
PV223485 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPB-C-His)
PV223486 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPB-N-His)
PV223487 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPM-C-HA)
PV223488 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPM-C-His)
PV223489 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPB-C-His)
PV223490 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPB-N-His)
PV223491 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPM-C-HA)
PV223492 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPM-C-His)
PV223493 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPB-C-His)
PV223494 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPB-N-His)
PV223495 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPM-C-HA)
PV223496 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPM-C-His)
PV223497 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPB-C-His)
PV223498 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPB-N-His)
PV223499 500 ng
EUR 603

REPIN1 Protein Vector (Mouse) (pPM-C-HA)
PV223500 500 ng
EUR 603

Mouse REPIN1(Replication Initiator 1) ELISA Kit