Mouse THBS3(Thrombospondin 3) ELISA Kit
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
RDR-THBS3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
RD-THBS3-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
RD-THBS3-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Thrombospondin 3 (THBS3) ELISA Kit |
DLR-THBS3-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 3 (THBS3) in samples from plasma. |
Human Thrombospondin 3 (THBS3) ELISA Kit |
DLR-THBS3-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Thrombospondin 3 (THBS3) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Thrombospondin 3 (THBS3) in samples from plasma. |
Human Thrombospondin 3 (THBS3) ELISA Kit |
RDR-THBS3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Thrombospondin 3 (THBS3) ELISA Kit |
RDR-THBS3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Human Thrombospondin 3 (THBS3) ELISA Kit |
RD-THBS3-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Thrombospondin 3 (THBS3) ELISA Kit |
RD-THBS3-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
20-abx154756 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
SED823Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma. |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
SED823Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma. |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
SED823Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma. |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
SED823Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 3 (THBS3) in Plasma. |
Mouse Thrombospondin 3 (THBS3) ELISA Kit |
4-SED823Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species. |
Mouse Thrombospondin-3 (Thbs3) |
1-CSB-YP023489MO |
Cusabio |
-
EUR 504.00
-
EUR 265.00
-
EUR 1832.00
-
EUR 763.00
-
EUR 1216.00
-
EUR 334.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 37.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in Yeast |
Mouse Thrombospondin-3 (Thbs3) |
1-CSB-EP023489MO |
Cusabio |
-
EUR 505.00
-
EUR 265.00
-
EUR 1827.00
-
EUR 766.00
-
EUR 1218.00
-
EUR 335.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 62.7 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Mouse Thrombospondin-3(Thbs3),partial expressed in E.coli |
ELISA kit for Mouse THBS3 (Thrombospondin 3) |
ELK6457 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
- Show more
|
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse Thrombospondin 3 (THBS3) CLIA Kit |
20-abx494399 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Mouse Thrombospondin 3 (THBS3) Protein |
20-abx655225 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Mouse Thrombospondin 3 (THBS3) Protein |
20-abx655226 |
Abbexa |
-
EUR 690.00
-
EUR 286.00
-
EUR 2124.00
-
EUR 815.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Human Thrombospondin 3 (THBS3) ELISA Kit |
20-abx156876 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Human Thrombospondin 3 (THBS3) ELISA Kit |
abx259888-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Human Thrombospondin 3 (THBS3) ELISA Kit |
SED823Hu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4731.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma. |
Human Thrombospondin 3 (THBS3) ELISA Kit |
SED823Hu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 477.3 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma. |
Human Thrombospondin 3 (THBS3) ELISA Kit |
SED823Hu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 639 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma. |
Human Thrombospondin 3 (THBS3) ELISA Kit |
SED823Hu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2575.5 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Thrombospondin 3 (THBS3) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Thrombospondin 3 (THBS3) in Plasma. |
Human Thrombospondin 3 (THBS3) ELISA Kit |
4-SED823Hu |
Cloud-Clone |
-
EUR 4782.00
-
EUR 2526.00
-
EUR 640.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Thrombospondin 3 elisa. Alternative names of the recognized antigen: TSP3
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Thrombospondin 3 (THBS3) in samples from Plasma. with no significant corss-reactivity with analogues from other species. |
Thrombospondin 3 (THBS3) Antibody |
20-abx123257 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
20-abx116967 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
20-abx128997 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Thrombospondin 3 (THBS3) Antibody |
20-abx110655 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
20-abx110656 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
abx030681-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
abx030681-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
20-abx320416 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody |
abx431668-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
Thrombospondin 3 (THBS3) Antibody |
abx238675-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Thrombospondin 3 (THBS3) Antibody |
20-abx178573 |
Abbexa |
|
|
|
Thrombospondin 3 (THBS3) Antibody |
20-abx178574 |
Abbexa |
-
EUR 439.00
-
EUR 133.00
-
EUR 1233.00
-
EUR 592.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-12 working days.
|
Recombinant Thrombospondin 3 (THBS3) |
4-RPD823Hu01 |
Cloud-Clone |
-
EUR 467.36
-
EUR 228.00
-
EUR 1477.60
-
EUR 559.20
-
EUR 1018.40
-
EUR 376.00
-
EUR 3544.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P49746
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 58.1kDa
- Isoelectric Point: Inquire
|
Description: Recombinant Human Thrombospondin 3 expressed in: E.coli |
ELISA kit for Human THBS3 (Thrombospondin 3) |
ELK5166 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 3 (THBS3). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
- Show more
|
Description: A sandwich ELISA kit for detection of Thrombospondin 3 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Human Thrombospondin 3 (THBS3) CLIA Kit |
20-abx494398 |
Abbexa |
-
EUR 7973.00
-
EUR 4246.00
-
EUR 981.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Thrombospondin 3 (THBS3) Antibody (HRP) |
20-abx109221 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody (HRP) |
20-abx109222 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Thrombospondin 3 (THBS3) Protein |
20-abx166577 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1998.00
-
EUR 773.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Thrombospondin 3 (THBS3) Antibody (Biotin) |
20-abx106391 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody (Biotin) |
20-abx106392 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody (FITC) |
20-abx107803 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Antibody (FITC) |
20-abx107804 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human) |
4-PAD823Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3) |
Polyclonal THBS3 / Thrombospondin 3 Antibody (C-Terminus) |
AMM08184G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human THBS3 / Thrombospondin 3 (C-Terminus). This antibody is tested and proven to work in the following applications: |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC |
4-PAD823Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC. |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Biotinylated |
4-PAD823Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Biotin. |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), Cy3 |
4-PAD823Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with Cy3. |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), FITC |
4-PAD823Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with FITC. |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), HRP |
4-PAD823Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with HRP. |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), PE |
4-PAD823Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with PE. |
Thrombospondin 3 (THBS3) Polyclonal Antibody (Human), APC-Cy7 |
4-PAD823Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: THBS3 (Asp670~Cys921)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Thrombospondin 3 (THBS3). This antibody is labeled with APC-Cy7. |
Thbs3 ELISA Kit (Mouse) (OKCD01781) |
OKCD01781 |
Aviva Systems Biology |
96 Wells |
EUR 857 |
Description: Description of target: Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. Can bind to fibrinogen, fibronectin, laminin and type V collagen. ;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 25.3 pg/mL |
THBS3 ELISA Kit (Human) (OKCD00691) |
OKCD00691 |
Aviva Systems Biology |
96 Wells |
EUR 831 |
Description: Description of target: Adhesive glycoprotein that mediates cell-to-cell and cell-to-matrix interactions. Can bind to fibrinogen, fibronectin, laminin and type V collagen. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.61 ng/mL |
Mouse THBS3 shRNA Plasmid |
20-abx973102 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
THBS3 siRNA |
20-abx936680 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
THBS3 siRNA |
20-abx936681 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
THBS3 antibody |
70R-21720 |
Fitzgerald |
50 ul |
EUR 435 |
Description: Rabbit polyclonal THBS3 antibody |
Thbs3 Antibody |
1-CSB-PA023489DA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Unconjugated. Tested in the following application: ELISA |
Thbs3 Antibody |
1-CSB-PA023489EA01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB; Recommended dilution: WB:1:1000-1:5000 |
THBS3 Antibody |
1-CSB-PA023489ESR2HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% sodium azide, 50% glycerol, pH7.3. Antigen Affinity Purified
|
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
THBS3 Antibody |
1-CSB-PA023489GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
Description: A polyclonal antibody against THBS3. Recognizes THBS3 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Mouse Thrombospondin 1 ELISA kit |
E03T0763-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Thrombospondin 1 ELISA kit |
E03T0763-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Thrombospondin 1 ELISA kit |
E03T0763-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Thbs3 sgRNA CRISPR Lentivector (Mouse) (Target 3) |
K4897004 |
ABM |
1.0 ug DNA |
EUR 154 |
Human Thrombospondin 3 (TSP-3)ELISA Kit |
201-12-2387 |
SunredBio |
96 tests |
EUR 440 |
- This Thrombospondin 3 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
|
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids. |
Thbs3 ORF Vector (Mouse) (pORF) |
ORF059522 |
ABM |
1.0 ug DNA |
EUR 506 |
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
abx518762-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
abx512335-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
abx513518-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
20-abx585067 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
abx572450-96tests |
Abbexa |
96 tests |
EUR 754 |
- Shipped within 5-12 working days.
|
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
20-abx572611 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
abx575980-96tests |
Abbexa |
96 tests |
EUR 786 |
- Shipped within 5-12 working days.
|
Mouse Thrombospondin 1(THBS1) ELISA kit |
E03T0686-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Thrombospondin 1(THBS1) ELISA kit |
E03T0686-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Thrombospondin 1(THBS1) ELISA kit |
E03T0686-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 1(THBS1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Thrombospondin 2(THBS2) ELISA kit |
E03T0687-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Thrombospondin 2(THBS2) ELISA kit |
E03T0687-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Thrombospondin 2(THBS2) ELISA kit |
E03T0687-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Mouse Thrombospondin 2(THBS2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Thbs4/ Thrombospondin-4 ELISA Kit |
E1467Mo |
Sunlong |
1 Kit |
EUR 571 |
Mouse Thbs1/ Thrombospondin-1 ELISA Kit |
E1678Mo |
Sunlong |
1 Kit |
EUR 546 |
Mouse thrombospondin 1(THBS1)ELISA Kit |
GA-E0668MS-48T |
GenAsia Biotech |
48T |
EUR 336 |
Mouse thrombospondin 1(THBS1)ELISA Kit |
GA-E0668MS-96T |
GenAsia Biotech |
96T |
EUR 534 |
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
20-abx154754 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
20-abx154755 |
Abbexa |
-
EUR 7378.00
-
EUR 3933.00
-
EUR 911.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
20-abx258715 |
Abbexa |
-
EUR 6642.00
-
EUR 3542.00
-
EUR 825.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
DLR-THBS1-Mu-48T |
DL Develop |
48T |
EUR 489 |
- Should the Mouse Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 1 (THBS1) in samples from plasma, tissue homogenates or other biological fluids. |
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
DLR-THBS1-Mu-96T |
DL Develop |
96T |
EUR 635 |
- Should the Mouse Thrombospondin 1 (THBS1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 1 (THBS1) in samples from plasma, tissue homogenates or other biological fluids. |
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
DLR-THBS2-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 2 (THBS2) in samples from plasma, tissue homogenates or other biological fluids. |
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
DLR-THBS2-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Thrombospondin 2 (THBS2) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 2 (THBS2) in samples from plasma, tissue homogenates or other biological fluids. |
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
DLR-THBS4-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 4 (THBS4) in samples from plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
DLR-THBS4-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Thrombospondin 4 (THBS4) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Thrombospondin 4 (THBS4) in samples from plasma, tissue homogenates, cell lysates, cell culture supernates or other biological fluids. |
Mouse Thrombospondin-2(THBS2) ELISA kit |
CSB-EL023488MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Thrombospondin-2 (THBS2) in samples from serum, plasma, tissue homogenates, cell lysates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Thrombospondin-2(THBS2) ELISA kit |
1-CSB-EL023488MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Thrombospondin-2(THBS2) in samples from serum, plasma, tissue homogenates, cell lysates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Thrombospondin-4(THBS4) ELISA kit |
CSB-EL023490MO-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Thrombospondin-4 (THBS4) in samples from serum, plasma, cell culture supernates, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse Thrombospondin-4(THBS4) ELISA kit |
1-CSB-EL023490MO |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse Thrombospondin-4(THBS4) in samples from serum, plasma, cell culture supernates, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
SEA611Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4391.16 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 1 (THBS1) in plasma, tissue homogenates and other biological fluids. |
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
SEA611Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 449.27 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 1 (THBS1) in plasma, tissue homogenates and other biological fluids. |
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
SEA611Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 598.96 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 1 (THBS1) in plasma, tissue homogenates and other biological fluids. |
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
SEA611Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2395.32 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 1 (THBS1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 1 (THBS1) in plasma, tissue homogenates and other biological fluids. |
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
4-SEA611Mu |
Cloud-Clone |
-
EUR 4442.00
-
EUR 2346.00
-
EUR 599.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Thrombospondin 1 elisa. Alternative names of the recognized antigen: TSP1
- Thrombospondin-1p180
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Thrombospondin 1 (THBS1) in samples from plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
RDR-THBS1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
RDR-THBS1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
RDR-THBS2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
RDR-THBS2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
RDR-THBS4-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
RDR-THBS4-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Mouse Thrombospondin 1 ELISA Kit (THBS1) |
RK03231 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Thrombospondin 2 ELISA Kit (THBS2) |
RK03232 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Thrombospondin 4 ELISA Kit (THBS4) |
RK03233 |
Abclonal |
96 Tests |
EUR 521 |
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
RD-THBS1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Thrombospondin 1 (THBS1) ELISA Kit |
RD-THBS1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
RD-THBS2-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
RD-THBS2-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
RD-THBS4-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
RD-THBS4-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
SED822Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 2 (THBS2) in plasma, tissue homogenates and other biological fluids. |
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
SED822Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 2 (THBS2) in plasma, tissue homogenates and other biological fluids. |
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
SED822Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 2 (THBS2) in plasma, tissue homogenates and other biological fluids. |
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
SED822Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 2 (THBS2) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 2 (THBS2) in plasma, tissue homogenates and other biological fluids. |
Mouse Thrombospondin 2 (THBS2) ELISA Kit |
4-SED822Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Thrombospondin 2 elisa. Alternative names of the recognized antigen: TSP2
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Thrombospondin 2 (THBS2) in samples from plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
SED824Mu-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 4862.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 4 (THBS4) in plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
SED824Mu-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 488.08 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 4 (THBS4) in plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
SED824Mu-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 654.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 4 (THBS4) in plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
SED824Mu-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2644.8 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Thrombospondin 4 (THBS4) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Thrombospondin 4 (THBS4) in plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids. |
Mouse Thrombospondin 4 (THBS4) ELISA Kit |
4-SED824Mu |
Cloud-Clone |
-
EUR 4913.00
-
EUR 2595.00
-
EUR 655.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Thrombospondin 4 elisa. Alternative names of the recognized antigen: TSP4
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Thrombospondin 4 (THBS4) in samples from plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species. |
THBS3 cloning plasmid |
CSB-CL023489HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1458
- Sequence: ATGGACAACAACAAACACTGCAAACAGGACAACTGCCTTTTGACACCCAACTCTGGGCAGGAAGATGCTGATAATGATGGTGTGGGGGACCAGTGTGATGATGATGCTGATGGGGATGGGATCAAGAATGTTGAGGACAACTGCCGGCTGTTCCCCAACAAAGACCAGCAGAACT
- Show more
|
Description: A cloning plasmid for the THBS3 gene. |
THBS3 Rabbit pAb |
A3641-100ul |
Abclonal |
100 ul |
EUR 308 |
THBS3 Rabbit pAb |
A3641-200ul |
Abclonal |
200 ul |
EUR 459 |
THBS3 Rabbit pAb |
A3641-20ul |
Abclonal |
20 ul |
EUR 183 |
THBS3 Rabbit pAb |
A3641-50ul |
Abclonal |
50 ul |
EUR 223 |
Thbs3 Polyclonal Antibody |
A57726 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: fast delivery possible |
Thbs3 Polyclonal Antibody |
A57777 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
Anti-THBS3 antibody |
STJ25845 |
St John's Laboratory |
100 µl |
EUR 277 |
Description: The protein encoded by this gene belongs to the thrombospondin family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentameric molecule linked by a single disulfide bond. This gene shares a common promoter with metaxin 1. Alternate splicing results in coding and non-coding transcript variants. |
Thbs2 ELISA Kit| Mouse Thrombospondin-2 ELISA Kit |
EF016376 |
Lifescience Market |
96 Tests |
EUR 689 |
Thbs3 sgRNA CRISPR Lentivector set (Mouse) |
K4897001 |
ABM |
3 x 1.0 ug |
EUR 339 |
ELISA kit for Mouse THBS2 (Thrombospondin 2) |
ELK6176 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 2 (THBS2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
- Show more
|
Description: A sandwich ELISA kit for detection of Thrombospondin 2 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse THBS4 (Thrombospondin 4) |
ELK6456 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 4 (THBS4). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
- Show more
|
Description: A sandwich ELISA kit for detection of Thrombospondin 4 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
ELISA kit for Mouse THBS1 (Thrombospondin 1) |
ELK1687 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Thrombospondin 1 (THBS1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Thrombosp
- Show more
|
Description: A sandwich ELISA kit for detection of Thrombospondin 1 from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Mouse thrombospondin 1, TSP-1 ELISA Kit |
CSB-E08765m-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse thrombospondin 1, TSP-1 in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Mouse thrombospondin 1, TSP-1 ELISA Kit |
1-CSB-E08765m |
Cusabio |
-
EUR 946.00
-
EUR 5782.00
-
EUR 3060.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Mouse thrombospondin 1, TSP-1 in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Mouse thrombospondin 1,TSP-1 ELISA Kit |
CN-02610M1 |
ChemNorm |
96T |
EUR 448 |
Mouse thrombospondin 1,TSP-1 ELISA Kit |
CN-02610M2 |
ChemNorm |
48T |
EUR 297 |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
THBS3 sgRNA CRISPR Lentivector (Human) (Target 3) |
K2368904 |
ABM |
1.0 ug DNA |
EUR 154 |
Thbs3 3'UTR GFP Stable Cell Line |
TU170448 |
ABM |
1.0 ml |
Ask for price |
THBS3 3'UTR GFP Stable Cell Line |
TU075528 |
ABM |
1.0 ml |
EUR 1521 |
Thbs3 3'UTR Luciferase Stable Cell Line |
TU120448 |
ABM |
1.0 ml |
Ask for price |
THBS3 3'UTR Luciferase Stable Cell Line |
TU025528 |
ABM |
1.0 ml |
EUR 1521 |
Human THBS3 shRNA Plasmid |
20-abx954831 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Thbs3 Antibody, HRP conjugated |
1-CSB-PA023489DB01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA |
Thbs3 Antibody, FITC conjugated |
1-CSB-PA023489DC01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA |
Thbs3 Antibody, Biotin conjugated |
1-CSB-PA023489DD01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Thbs3 Antibody, HRP conjugated |
1-CSB-PA023489EB01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is HRP conjugated. Tested in the following application: ELISA |
Thbs3 Antibody, FITC conjugated |
1-CSB-PA023489EC01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is FITC conjugated. Tested in the following application: ELISA |
Thbs3 Antibody, Biotin conjugated |
1-CSB-PA023489ED01MO |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against Thbs3. Recognizes Thbs3 from Mouse. This antibody is Biotin conjugated. Tested in the following application: ELISA |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Mouse anti-dsDNA IgG3-specific ELISA Kit, 96 tests, Quantitative |
5120-3 |
Alpha Diagnostics |
1 kit |
EUR 712 |
Dr. P Kit-Solution 3 |
K2021010-3 |
Biochain |
50 ml |
EUR 133 |
Description: Can be used for various proteomics studies in both normal and pathological cases. It is an excellent control and suitable for educational purposes. This product is prepared from whole tissue homogenates and has undergone SDS-PAGE quality control analysis. The protein is stored in a buffer with protease inhibitor cocktail fo prevent degradation. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
Human Thrombospondin 1 ELISA kit |
E01T0763-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thrombospondin 1 ELISA kit |
E01T0763-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Thrombospondin 1 ELISA kit |
E01T0763-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Human Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Thrombospondin 1 ELISA kit |
E02T0763-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Thrombospondin 1 ELISA kit |
E02T0763-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Thrombospondin 1 ELISA kit |
E02T0763-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Thrombospondin 1 ELISA kit |
E04T0763-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Thrombospondin 1 ELISA kit |
E04T0763-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Thrombospondin 1 ELISA kit |
E04T0763-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Rabbit Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Thrombospondin 1 ELISA kit |
E08T0763-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Thrombospondin 1 ELISA kit |
E08T0763-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Thrombospondin 1 ELISA kit |
E08T0763-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Canine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Thrombospondin 1 ELISA kit |
E07T0763-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Thrombospondin 1 ELISA kit |
E07T0763-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Thrombospondin 1 ELISA kit |
E07T0763-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Porcine Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Thrombospondin 1 ELISA kit |
E06T0763-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Thrombospondin 1 ELISA kit |
E06T0763-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Thrombospondin 1 ELISA kit |
E06T0763-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A competitive ELISA for quantitative measurement of Goat Thrombospondin 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse THBS3(Thrombospondin 3) ELISA Kit