Mouse TREH(Trehalase) ELISA Kit

Mouse TREH(Trehalase) ELISA Kit

Mouse Trehalase (TREH) ELISA Kit
RDR-TREH-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Mouse Trehalase (TREH) ELISA Kit
RD-TREH-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Trehalase (TREH) ELISA Kit
RD-TREH-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Human Trehalase (TREH) ELISA Kit
DLR-TREH-Hu-48T	DL Develop	48T	EUR 517
Should the Human Trehalase (TREH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Trehalase (TREH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Trehalase (TREH) ELISA Kit
DLR-TREH-Hu-96T	DL Develop	96T	EUR 673
Should the Human Trehalase (TREH) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Trehalase (TREH) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Trehalase (TREH) ELISA Kit
RDR-TREH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Trehalase (TREH) ELISA Kit
RDR-TREH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Human Trehalase (TREH) ELISA Kit
RD-TREH-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Trehalase (TREH) ELISA Kit
RD-TREH-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Trehalase (TREH) ELISA Kit
20-abx154804	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Trehalase, Treh ELISA KIT
ELI-16880m	Lifescience Market	96 Tests	EUR 865

Mouse Trehalase (TREH) ELISA Kit
SEG871Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Trehalase (TREH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Trehalase (TREH) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Trehalase (TREH) ELISA Kit
SEG871Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Trehalase (TREH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Trehalase (TREH) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Trehalase (TREH) ELISA Kit
SEG871Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Trehalase (TREH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Trehalase (TREH) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Trehalase (TREH) ELISA Kit
SEG871Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Trehalase (TREH) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Trehalase (TREH) in serum, plasma, tissue homogenates and other biological fluids.

Mouse Trehalase (TREH) ELISA Kit
4-SEG871Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Trehalase elisa. Alternative names of the recognized antigen: TRE TREA Brush Border Membrane Glycoprotein Alpha, Alpha-Trehalase Alpha, Alpha-Trehalose Glucohydrolase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Trehalase (TREH) in samples from Serum, plasma, tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

ELISA kit for Mouse TREH (Trehalase)
ELK6623	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Trehalase (TREH). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Trehalase (TREH). Show more
Description: A sandwich ELISA kit for detection of Trehalase from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse Trehalase (TREH)
KTE70059-48T	Abbkine	48T	EUR 332
Trehalose (1-alpha-D-glucopyranosyl alpha-D-glucopyranoside) is widely distributed in nature, being the storage disaccharide of fungi and the blood sugar of insects. Trehalase (EC 3.2.1.28) is an intrinsic glycoprotein of the small intestine and rena Show more
Description: Quantitative sandwich ELISA for measuring Mouse Trehalase (TREH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Trehalase (TREH)
KTE70059-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Trehalose (1-alpha-D-glucopyranosyl alpha-D-glucopyranoside) is widely distributed in nature, being the storage disaccharide of fungi and the blood sugar of insects. Trehalase (EC 3.2.1.28) is an intrinsic glycoprotein of the small intestine and rena Show more
Description: Quantitative sandwich ELISA for measuring Mouse Trehalase (TREH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Trehalase (TREH)
KTE70059-96T	Abbkine	96T	EUR 539
Trehalose (1-alpha-D-glucopyranosyl alpha-D-glucopyranoside) is widely distributed in nature, being the storage disaccharide of fungi and the blood sugar of insects. Trehalase (EC 3.2.1.28) is an intrinsic glycoprotein of the small intestine and rena Show more
Description: Quantitative sandwich ELISA for measuring Mouse Trehalase (TREH) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Trehalase (TREH) CLIA Kit
20-abx495314	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Trehalase (TREH) Protein
20-abx168356	Abbexa	EUR 676.00 EUR 286.00 EUR 2082.00 EUR 801.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Trehalase, TREH ELISA KIT
ELI-36552h	Lifescience Market	96 Tests	EUR 824

Rabbit Trehalase, TREH ELISA KIT
ELI-40079Ra	Lifescience Market	96 Tests	EUR 928

Human Trehalase(TREH)ELISA Kit
QY-E03233	Qayee Biotechnology	96T	EUR 361

Trehalase (TREH) Antibody
20-abx178711	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Trehalase (TREH) Antibody
20-abx128642	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Trehalase (TREH) Antibody
20-abx129790	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Trehalase (TREH) Antibody
abx145339-100ug	Abbexa	100 ug	EUR 391
Shipped within 5-10 working days.

Recombinant Trehalase (TREH)
4-RPG871Hu01	Cloud-Clone	EUR 467.36 EUR 228.00 EUR 1477.60 EUR 559.20 EUR 1018.40 EUR 376.00 EUR 3544.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O43280 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 24.9kDa Isoelectric Point: 6.1
Description: Recombinant Human Trehalase expressed in: E.coli

Recombinant Trehalase (TREH)
4-RPG871Mu01	Cloud-Clone	EUR 485.28 EUR 233.00 EUR 1544.80 EUR 581.60 EUR 1063.20 EUR 388.00 EUR 3712.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q9JLT2 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 33.4kDa Isoelectric Point: 6.2
Description: Recombinant Mouse Trehalase expressed in: E.coli

Human Trehalase (TREH) Protein
20-abx166569	Abbexa	EUR 648.00 EUR 272.00 EUR 1998.00 EUR 773.00 EUR 467.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Trehalase (TREH) Polyclonal Antibody (Human, Mouse)
4-PAG871Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (His237~Pro420) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH)

Trehalase (TREH) Polyclonal Antibody (Mouse, Rat)
4-PAG871Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (Ser151~Tyr411) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH)

Trehalase (TREH) Polyclonal Antibody (Human, Mouse), APC
4-PAG871Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (His237~Pro420) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with APC.

Trehalase (TREH) Polyclonal Antibody (Human, Mouse), Biotinylated
4-PAG871Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (His237~Pro420) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with Biotin.

Trehalase (TREH) Polyclonal Antibody (Human, Mouse), Cy3
4-PAG871Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (His237~Pro420) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with Cy3.

Trehalase (TREH) Polyclonal Antibody (Human, Mouse), FITC
4-PAG871Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (His237~Pro420) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with FITC.

Trehalase (TREH) Polyclonal Antibody (Human, Mouse), HRP
4-PAG871Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (His237~Pro420) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with HRP.

Trehalase (TREH) Polyclonal Antibody (Human, Mouse), PE
4-PAG871Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (His237~Pro420) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with PE.

Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), APC
4-PAG871Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (Ser151~Tyr411) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with APC.

Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), Biotinylated
4-PAG871Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (Ser151~Tyr411) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with Biotin.

Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), Cy3
4-PAG871Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (Ser151~Tyr411) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with Cy3.

Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), FITC
4-PAG871Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (Ser151~Tyr411) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with FITC.

Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), HRP
4-PAG871Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (Ser151~Tyr411) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with HRP.

Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), PE
4-PAG871Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (Ser151~Tyr411) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with PE.

Trehalase (TREH) Polyclonal Antibody (Human, Mouse), APC-Cy7
4-PAG871Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (His237~Pro420) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human, Mouse Trehalase (TREH). This antibody is labeled with APC-Cy7.

Trehalase (TREH) Polyclonal Antibody (Mouse, Rat), APC-Cy7
4-PAG871Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: TREH (Ser151~Tyr411) Buffer composition: PBS, pH7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
Description: A Rabbit polyclonal antibody against Mouse, Rat Trehalase (TREH). This antibody is labeled with APC-Cy7.

TREH ELISA Kit (Mouse) (OKCD01166)
OKCD01166	Aviva Systems Biology	96 Wells	EUR 857
Description: Description of target: Intestinal trehalase is probably involved in the hydrolysis of ingested trehalose. ;Species reactivity: Mouse;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.216 ng/mL

Trehalase Assay Kit
abx096014-100Assays	Abbexa	100 Assays	EUR 551
Shipped within 5-10 working days.

Trehalase antibody
23114-100ul	SAB	100ul	EUR 390

Trehalase antibody
70R-13329	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal Trehalase antibody

Mouse TREH shRNA Plasmid
20-abx975117	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TREH Recombinant Protein (Mouse)
RP180962	ABM	100 ug	Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

TREH Antibody
1-CSB-PA024402LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TREH. Recognizes TREH from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IF; Recommended dilution: IF:1:50-1:200

TREH siRNA
20-abx937974	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

TREH siRNA
20-abx937975	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

Mouse Acid trehalase like protein 1(ATHL1) ELISA kit
E03A1753-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acid trehalase like protein 1(ATHL1) ELISA kit
E03A1753-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acid trehalase like protein 1(ATHL1) ELISA kit
E03A1753-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Acid trehalase- like protein 1, Athl1 ELISA KIT
ELI-11412m	Lifescience Market	96 Tests	EUR 865

Mouse Acid Trehalase-Like Protein 1 (ATHL1) ELISA Kit
abx388626-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Athl1 ELISA Kit| Mouse Acid trehalase-like protein 1 ELISA Kit
EF014251	Lifescience Market	96 Tests	EUR 689

Treh ORF Vector (Mouse) (pORF)
ORF060322	ABM	1.0 ug DNA	EUR 506

Neutral trehalase Antibody
20-abx110630	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

TREH Polyclonal Antibody
28947-100ul	SAB	100ul	EUR 252

TREH Polyclonal Antibody
28947-50ul	SAB	50ul	EUR 187

TREH Rabbit pAb
A15397-100ul	Abclonal	100 ul	EUR 308

TREH Rabbit pAb
A15397-200ul	Abclonal	200 ul	EUR 459

TREH Rabbit pAb
A15397-20ul	Abclonal	20 ul	EUR 183

TREH Rabbit pAb
A15397-50ul	Abclonal	50 ul	EUR 223

TREH cloning plasmid
CSB-CL024402HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1659 Sequence: ATGCCAGGGAGGACCTGGGAGCTGTGCCTGCTACTGCTGCTGGGGCTGGGACTGGGGTCCCAGGAGGCCCTACCCCCACCCTGTGAGAGTGAGATTTACTGCCACGGGGAGCTCCTAAACCAAGTTCAAATGGCCAAGCTCTACCAGGATGACAAGCAGTTTGTGGACATGCCAC Show more
Description: A cloning plasmid for the TREH gene.

Anti-TREH antibody
STJ117592	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. A partial duplication of this gene is located adjacent to this locus on chromosome 11. Two transcript variants encoding different isoforms have been found for this gene.

Treh sgRNA CRISPR Lentivector set (Mouse)
K3815801	ABM	3 x 1.0 ug	EUR 339

Neutral trehalase Antibody (Biotin)
20-abx106363	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neutral trehalase Antibody (FITC)
20-abx107776	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Neutral trehalase Antibody (HRP)
20-abx109193	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

TREH Polyclonal Conjugated Antibody
C28947	SAB	100ul	EUR 397

TREH Antibody, HRP conjugated
1-CSB-PA024402LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TREH. Recognizes TREH from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

TREH Antibody, FITC conjugated
1-CSB-PA024402LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TREH. Recognizes TREH from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

TREH Antibody, Biotin conjugated
1-CSB-PA024402LD01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, pH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against TREH. Recognizes TREH from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

Human TREH shRNA Plasmid
20-abx957661	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

TREH Recombinant Protein (Rat)
RP234584	ABM	100 ug	Ask for price

TREH Recombinant Protein (Human)
RP044434	ABM	100 ug	Ask for price

Human Acid trehalase like protein 1(ATHL1) ELISA kit
E01A1753-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acid trehalase like protein 1(ATHL1) ELISA kit
E01A1753-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acid trehalase like protein 1(ATHL1) ELISA kit
E01A1753-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acid trehalase like protein 1(ATHL1) ELISA kit
E02A1753-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acid trehalase like protein 1(ATHL1) ELISA kit
E02A1753-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Acid trehalase like protein 1(ATHL1) ELISA kit
E02A1753-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acid trehalase like protein 1(ATHL1) ELISA kit
E06A1753-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acid trehalase like protein 1(ATHL1) ELISA kit
E06A1753-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Acid trehalase like protein 1(ATHL1) ELISA kit
E06A1753-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acid trehalase like protein 1(ATHL1) ELISA kit
E04A1753-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acid trehalase like protein 1(ATHL1) ELISA kit
E04A1753-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Acid trehalase like protein 1(ATHL1) ELISA kit
E04A1753-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acid trehalase like protein 1(ATHL1) ELISA kit
E07A1753-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acid trehalase like protein 1(ATHL1) ELISA kit
E07A1753-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Acid trehalase like protein 1(ATHL1) ELISA kit
E07A1753-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acid trehalase like protein 1(ATHL1) ELISA kit
E08A1753-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acid trehalase like protein 1(ATHL1) ELISA kit
E08A1753-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Acid trehalase like protein 1(ATHL1) ELISA kit
E08A1753-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acid trehalase like protein 1(ATHL1) ELISA kit
E09A1753-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acid trehalase like protein 1(ATHL1) ELISA kit
E09A1753-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Acid trehalase like protein 1(ATHL1) ELISA kit
E09A1753-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Acid trehalase- like protein 1, ATHL1 ELISA KIT
ELI-11363h	Lifescience Market	96 Tests	EUR 824

Human Acid Trehalase-Like Protein 1 (ATHL1) ELISA Kit
abx384605-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

PCR Mycoplasma Detection Kit
M034-Kit	TOKU-E	Kit	EUR 266

Treh sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3815802	ABM	1.0 ug DNA	EUR 154

Treh sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3815803	ABM	1.0 ug DNA	EUR 154

Treh sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3815804	ABM	1.0 ug DNA	EUR 154

TREH Protein Vector (Mouse) (pPB-C-His)
PV241286	ABM	500 ng	EUR 603

TREH Protein Vector (Mouse) (pPB-N-His)
PV241287	ABM	500 ng	EUR 603

TREH Protein Vector (Mouse) (pPM-C-HA)
PV241288	ABM	500 ng	EUR 603

TREH Protein Vector (Mouse) (pPM-C-His)
PV241289	ABM	500 ng	EUR 603

Saccharomyces cerevisiae Neutral trehalase (NTH1)
1-CSB-RP181594Ye(c)	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 27.6 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Saccharomyces cerevisiae Neutral trehalase(NTH1),partial expressed in E.coli

Saccharomyces cerevisiae Neutral trehalase (NTH1)
1-CSB-RP181594Ye(N)	Cusabio	EUR 611.00 EUR 309.00 EUR 1827.00 EUR 939.00 EUR 1218.00 EUR 397.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 28.8 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Saccharomyces cerevisiae Neutral trehalase(NTH1),partial expressed in E.coli

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit
CAS400A-KIT	SBI	1 kit (10 rxn)	EUR 1110
Category: Cas9

Guinea pig Acid trehalase like protein 1(ATHL1) ELISA kit
E05A1753-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Acid trehalase like protein 1(ATHL1) ELISA kit
E05A1753-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Acid trehalase like protein 1(ATHL1) ELISA kit
E05A1753-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Acid trehalase like protein 1(ATHL1) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV100PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV105PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV120PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit
CASLV125PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS700A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS720A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector
CAS740A-KIT	SBI	10 rxn	EUR 1132
Category: Cas9

Polyclonal TREH Antibody - middle region
APR10540G	Leading Biology	0.05mg	EUR 528
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human TREH - middle region. This antibody is tested and proven to work in the following applications:

Treh ORF Vector (Rat) (pORF)
ORF078196	ABM	1.0 ug DNA	EUR 506

TREH ORF Vector (Human) (pORF)
ORF014812	ABM	1.0 ug DNA	EUR 354

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV200PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV205PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit
CASLV220PA-KIT	SBI	1 Kit	EUR 1132
Category: Cas9

Mouse TREH(Trehalase) ELISA Kit