Rat CES1(Carboxylesterase 1) ELISA Kit

Rat CES1(Carboxylesterase 1) ELISA Kit

Rat Carboxylesterase 1 (CES1) ELISA Kit
RDR-CES1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 811

Rat Carboxylesterase 1 (CES1) ELISA Kit
RD-CES1-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Carboxylesterase 1 (CES1) ELISA Kit
RD-CES1-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Carboxylesterase 1 (CES1) ELISA Kit
DLR-CES1-Hu-48T	DL Develop	48T	EUR 517
Should the Human Carboxylesterase 1 (CES1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxylesterase 1 (CES1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Carboxylesterase 1 (CES1) ELISA Kit
DLR-CES1-Hu-96T	DL Develop	96T	EUR 673
Should the Human Carboxylesterase 1 (CES1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Carboxylesterase 1 (CES1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Carboxylesterase 1 (CES1) ELISA Kit
DLR-CES1-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Carboxylesterase 1 (CES1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Carboxylesterase 1 (CES1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Carboxylesterase 1 (CES1) ELISA Kit
DLR-CES1-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Carboxylesterase 1 (CES1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Carboxylesterase 1 (CES1) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Carboxylesterase 1 (CES1) ELISA Kit
RDR-CES1-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Carboxylesterase 1 (CES1) ELISA Kit
RDR-CES1-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Carboxylesterase 1 (CES1) ELISA Kit
RDR-CES1-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Carboxylesterase 1 (CES1) ELISA Kit
RDR-CES1-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Rat Carboxylesterase 1 (CES1) ELISA Kit
20-abx155297	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Carboxylesterase 1(CES1)ELISA Kit
GA-E0865RT-48T	GenAsia Biotech	48T	EUR 336

Rat Carboxylesterase 1(CES1)ELISA Kit
GA-E0865RT-96T	GenAsia Biotech	96T	EUR 534

Rat Carboxylesterase 1(CES1)ELISA Kit
QY-E10787	Qayee Biotechnology	96T	EUR 361

Rat Carboxylesterase 1 (CES1) ELISA Kit
SEC374Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxylesterase 1 (CES1) ELISA Kit
SEC374Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxylesterase 1 (CES1) ELISA Kit
SEC374Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxylesterase 1 (CES1) ELISA Kit
SEC374Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Rat Carboxylesterase 1 (CES1) ELISA Kit
4-SEC374Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Carboxylesterase 1 elisa. Alternative names of the recognized antigen: ACAT CEH CES2 HMSE1 PCE1 SES1 TGH Retinyl ester hydrolase Serine esterase 1 Triacylglycerol hydrolase Egasyn Cocaine carboxylesterase Liver Carboxylester Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Carboxylesterase 1 (CES1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Anti-Liver Carboxylesterase 1/CES1 Antibody
A01741-1	BosterBio	100ug/vial	EUR 334

ELISA kit for Rat CES1 (Carboxylesterase 1)
ELK6493	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxylesterase 1 (CES1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxyl Show more
Description: A sandwich ELISA kit for detection of Carboxylesterase 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Carboxylesterase 1 (CES1) CLIA Kit
20-abx493648	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Carboxylesterase 1 (CES1) Protein
20-abx168932	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Human Carboxylesterase 1 (CES1)ELISA Kit
201-12-2396	SunredBio	96 tests	EUR 440
This Carboxylesterase 1 ELISA kit is validated to work with samples from whole blood, serum, plasma and cell culture supernatant.
Description: A quantitative ELISA kit for measuring Human in samples from biological fluids.

Human Carboxylesterase 1 (CES1) ELISA Kit
20-abx156849	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Carboxylesterase 1 (CES1) ELISA Kit
abx576674-96tests	Abbexa	96 tests	EUR 864
Shipped within 5-12 working days.

Human Carboxylesterase 1(CES1)ELISA Kit
QY-E01350	Qayee Biotechnology	96T	EUR 361

Human Carboxylesterase 1 (CES1) ELISA Kit
SEC374Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 1 (CES1) ELISA Kit
SEC374Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 1 (CES1) ELISA Kit
SEC374Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 1 (CES1) ELISA Kit
SEC374Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 1 (CES1) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 1 (CES1) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 1 (CES1) ELISA Kit
4-SEC374Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Carboxylesterase 1 elisa. Alternative names of the recognized antigen: ACAT CEH CES2 HMSE1 PCE1 SES1 TGH Retinyl ester hydrolase Serine esterase 1 Triacylglycerol hydrolase Egasyn Cocaine carboxylesterase Liver Carboxylester Show more
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxylesterase 1 (CES1) in samples from Serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Carboxylesterase 1(CES1)ELISA Kit
QY-E20255	Qayee Biotechnology	96T	EUR 361

Active Carboxylesterase 1 (CES1)
4-APC374Hu01	Cloud-Clone	EUR 664.48 EUR 281.00 EUR 2216.80 EUR 805.60 EUR 1511.20 EUR 508.00 EUR 5392.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P23141 Buffer composition: 20mM Tris, 150mM NaCl, pH8.0, containing 1mM EDTA, 1mM DTT, 0.01% SKL, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.0kDa Isoelectric Point: 6.8
Description: Recombinant Human Carboxylesterase 1 expressed in: Gallus

Carboxylesterase 1 (CES1) Antibody
20-abx111385	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Carboxylesterase 1 (CES1) Antibody
20-abx130593	Abbexa	EUR 453.00 EUR 133.00 EUR 1302.00 EUR 620.00 EUR 342.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Carboxylesterase 1 (CES1) Antibody
20-abx130594	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Carboxylesterase 1 (CES1) Antibody
20-abx130595	Abbexa	EUR 425.00 EUR 133.00 EUR 1205.00 EUR 578.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Carboxylesterase 1 (CES1) Antibody
20-abx141637	Abbexa	EUR 370.00 EUR 606.00 EUR 300.00	100 ul 200 ul 50 ul
Shipped within 5-10 working days.

Carboxylesterase 1 (CES1) Antibody
20-abx171560	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Carboxylesterase 1 (CES1) Antibody
20-abx318174	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Carboxylesterase 1 (CES1) Antibody
abx432495-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Carboxylesterase 1 (CES1) Antibody
abx231615-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Carboxylesterase 1 (CES1) Antibody
20-abx001532	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Recombinant Carboxylesterase 1 (CES1)
4-RPC374Hu01	Cloud-Clone	EUR 476.32 EUR 230.00 EUR 1511.20 EUR 570.40 EUR 1040.80 EUR 382.00 EUR 3628.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: P23141 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.0kDa Isoelectric Point: Inquire
Description: Recombinant Human Carboxylesterase 1 expressed in: E.coli

Recombinant Carboxylesterase 1 (CES1)
4-RPC374Mu01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q8VCC2 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 31.5kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Carboxylesterase 1 expressed in: E.coli

Recombinant Carboxylesterase 1 (CES1)
4-RPC374Ra01	Cloud-Clone	EUR 503.20 EUR 238.00 EUR 1612.00 EUR 604.00 EUR 1108.00 EUR 400.00 EUR 3880.00	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: Q63108 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 34.1kDa Isoelectric Point: Inquire
Description: Recombinant Rat Carboxylesterase 1 expressed in: E.coli

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat)
4-PAC374Ra01	Cloud-Clone	EUR 259.00 EUR 2708.00 EUR 670.00 EUR 328.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (His19~Leu300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1)

Mouse Liver carboxylesterase 1, Ces1 ELISA KIT
ELI-09262m	Lifescience Market	96 Tests	EUR 865

ELISA kit for Human CES1 (Carboxylesterase 1)
ELK5131	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxylesterase 1 (CES1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxyl Show more
Description: A sandwich ELISA kit for detection of Carboxylesterase 1 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Human Liver carboxylesterase 1, CES1 ELISA KIT
ELI-48044h	Lifescience Market	96 Tests	EUR 824

Human Carboxylesterase 1 (CES1) CLIA Kit
20-abx493647	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Carboxylesterase 1 (CES1) Protein
20-abx168930	Abbexa	EUR 662.00 EUR 272.00 EUR 2040.00 EUR 787.00 EUR 481.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Mouse Carboxylesterase 1 (CES1) Protein
20-abx168931	Abbexa	EUR 704.00 EUR 286.00 EUR 2165.00 EUR 829.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Carboxylesterase 1 (CES1) Antibody (HRP)
20-abx303388	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Carboxylesterase 1 (CES1) Antibody (FITC)
20-abx303389	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Carboxylesterase 1 (CES1) Antibody (Biotin)
20-abx303390	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), APC
4-PAC374Ra01-APC	Cloud-Clone	EUR 364.00 EUR 3545.00 EUR 980.00 EUR 467.00 EUR 227.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (His19~Leu300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with APC.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), Biotinylated
4-PAC374Ra01-Biotin	Cloud-Clone	EUR 325.00 EUR 2658.00 EUR 777.00 EUR 400.00 EUR 225.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (His19~Leu300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with Biotin.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), Cy3
4-PAC374Ra01-Cy3	Cloud-Clone	EUR 444.00 EUR 4685.00 EUR 1265.00 EUR 581.00 EUR 261.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (His19~Leu300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with Cy3.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), FITC
4-PAC374Ra01-FITC	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (His19~Leu300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with FITC.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), HRP
4-PAC374Ra01-HRP	Cloud-Clone	EUR 332.00 EUR 3089.00 EUR 866.00 EUR 421.00 EUR 213.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (His19~Leu300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with HRP.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), PE
4-PAC374Ra01-PE	Cloud-Clone	EUR 311.00 EUR 2856.00 EUR 804.00 EUR 393.00 EUR 202.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (His19~Leu300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with PE.

Ces1 ELISA Kit| Mouse Liver carboxylesterase 1 ELISA Kit
EF014398	Lifescience Market	96 Tests	EUR 689

Polyclonal Carboxylesterase 1 / CES1 Antibody (Internal)
APG02362G	Leading Biology	0.05mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Carboxylesterase 1 / CES1 (Internal). This antibody is tested and proven to work in the following applications:

Human Carboxylesterase 1 (CES1) Protein (Active)
20-abx655873	Abbexa	EUR 913.00 EUR 328.00 EUR 2973.00 EUR 1107.00 EUR 634.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human)
4-PAC374Hu01	Cloud-Clone	EUR 247.00 EUR 2510.00 EUR 625.00 EUR 310.00 EUR 214.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly18~Leu299) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1)

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse)
4-PAC374Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly31~Arg286) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1)

Carboxylesterase 1 (CES1) Polyclonal Antibody (Rat), APC-Cy7
4-PAC374Ra01-APC-Cy7	Cloud-Clone	EUR 608.00 EUR 6970.00 EUR 1840.00 EUR 814.00 EUR 335.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (His19~Leu300) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Carboxylesterase 1 (CES1). This antibody is labeled with APC-Cy7.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), APC
4-PAC374Hu01-APC	Cloud-Clone	EUR 345.00 EUR 3275.00 EUR 912.00 EUR 440.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly18~Leu299) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with APC.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), Biotinylated
4-PAC374Hu01-Biotin	Cloud-Clone	EUR 311.00 EUR 2460.00 EUR 727.00 EUR 381.00 EUR 219.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly18~Leu299) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with Biotin.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), Cy3
4-PAC374Hu01-Cy3	Cloud-Clone	EUR 419.00 EUR 4325.00 EUR 1175.00 EUR 545.00 EUR 251.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly18~Leu299) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with Cy3.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), FITC
4-PAC374Hu01-FITC	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly18~Leu299) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with FITC.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), HRP
4-PAC374Hu01-HRP	Cloud-Clone	EUR 316.00 EUR 2855.00 EUR 807.00 EUR 398.00 EUR 206.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly18~Leu299) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with HRP.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), PE
4-PAC374Hu01-PE	Cloud-Clone	EUR 296.00 EUR 2640.00 EUR 750.00 EUR 372.00 EUR 195.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly18~Leu299) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with PE.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), APC
4-PAC374Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly31~Arg286) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with APC.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), Biotinylated
4-PAC374Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly31~Arg286) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with Biotin.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), Cy3
4-PAC374Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly31~Arg286) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with Cy3.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), FITC
4-PAC374Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly31~Arg286) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with FITC.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), HRP
4-PAC374Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly31~Arg286) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with HRP.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), PE
4-PAC374Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly31~Arg286) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with PE.

Ces1/ Rat Ces1 ELISA Kit
ELI-26913r	Lifescience Market	96 Tests	EUR 886

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Carboxylesterase 1 (CES1) Polyclonal Antibody (Human), APC-Cy7
4-PAC374Hu01-APC-Cy7	Cloud-Clone	EUR 571.00 EUR 6430.00 EUR 1705.00 EUR 760.00 EUR 319.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly18~Leu299) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Carboxylesterase 1 (CES1). This antibody is labeled with APC-Cy7.

Carboxylesterase 1 (CES1) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC374Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: CES1 (Gly31~Arg286) Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Carboxylesterase 1 (CES1). This antibody is labeled with APC-Cy7.

Rat Carboxylesterase 1 ELISA kit
E02C0060-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylesterase 1 ELISA kit
E02C0060-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylesterase 1 ELISA kit
E02C0060-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Ces1 ELISA Kit (Rat) (OKEH08795)
OKEH08795	Aviva Systems Biology	96 Wells	EUR 896
Description: Description of target: ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 10pg/mL

Human Carboxylesterase 1 ELISA kit
E01C0060-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxylesterase 1 ELISA kit
E01C0060-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxylesterase 1 ELISA kit
E01C0060-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxylesterase 1 ELISA kit
E03C0060-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxylesterase 1 ELISA kit
E03C0060-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxylesterase 1 ELISA kit
E03C0060-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxylesterase 1 ELISA kit
E06C0060-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxylesterase 1 ELISA kit
E06C0060-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxylesterase 1 ELISA kit
E06C0060-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxylesterase 1 ELISA kit
E04C0060-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxylesterase 1 ELISA kit
E04C0060-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxylesterase 1 ELISA kit
E04C0060-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxylesterase 1 ELISA kit
E09C0060-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxylesterase 1 ELISA kit
E09C0060-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxylesterase 1 ELISA kit
E09C0060-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxylesterase 1 ELISA kit
E08C0060-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxylesterase 1 ELISA kit
E08C0060-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxylesterase 1 ELISA kit
E08C0060-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxylesterase 1 ELISA kit
E07C0060-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxylesterase 1 ELISA kit
E07C0060-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxylesterase 1 ELISA kit
E07C0060-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

CES1 ELISA KIT|Human
EF008614	Lifescience Market	96 Tests	EUR 689

Guinea pig Carboxylesterase 1 ELISA kit
E05C0060-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Carboxylesterase 1 ELISA kit
E05C0060-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Carboxylesterase 1 ELISA kit
E05C0060-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig Carboxylesterase 1 in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylesterase 3(CES3) ELISA kit
E02C1625-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylesterase 3(CES3) ELISA kit
E02C1625-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylesterase 3(CES3) ELISA kit
E02C1625-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Carboxylesterase 5A (CES5A) ELISA Kit
abx256649-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

ELISA kit for Rat Carboxylesterase 5A
EK4754	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Rat Carboxylesterase 5A in samples from serum, plasma, tissue homogenates and other biological fluids.

Rat Ces5a/ Carboxylesterase 5A ELISA Kit
E1058Ra	Sunlong	1 Kit	EUR 646

Rat Ces5a(Carboxylesterase 5A) ELISA Kit
ER0674	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q5GRG2 Alias: Ces5a/Carboxylesterase-like urinary excreted protein homolog(Cauxin)/Epididymis-specific gene 615 protein/
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Rattus;Sensitivity: 0.188 ng/ml

Human CES1 PicoKine ELISA Kit
EK1813	BosterBio	96 wells	EUR 425
Description: For quantitative detection of human CES1 in cell culture supernates, serum and plasma (heparin, EDTA).

CES1 ELISA Kit (Human) (OKCD01667)
OKCD01667	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Involved in the detoxification of xenobiotics and in the activation of ester and amide prodrugs. Hydrolyzes aromatic and aliphatic esters, but has no catalytic activity toward amides or a fatty acyl-CoA ester. Hydrolyzes the methyl ester group of cocaine to form benzoylecgonine. Catalyzes the transesterification of cocaine to form cocaethylene. Displays fatty acid ethyl ester synthase activity, catalyzing the ethyl esterification of oleic acid to ethyloleate.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.057 ng/mL

CES1 ELISA Kit (Human) (OKBB01240)
OKBB01240	Aviva Systems Biology	96 Wells	EUR 505
Description: Description of target: Liver carboxylesterase 1 also known as carboxylesterase 1 (CES1, hCE-1 or CES1A1) is an enzyme that in humans is encoded by the CES1 gene. This gene is mapped to 16q12.2. It encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: ;Sensitivity: <0.1ng/ml

Ces5a ELISA Kit| Rat Carboxylesterase 5A ELISA Kit
EF017489	Lifescience Market	96 Tests	EUR 689

Carboxylesterase 1 antibody
70R-1213	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal Carboxylesterase 1 antibody

Carboxylesterase 1 antibody
70R-1223	Fitzgerald	100 ug	EUR 377
Description: Rabbit polyclonal Carboxylesterase 1 antibody

CES1 antibody
70R-16360	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal CES1 antibody

CES1 Antibody
32472-100ul	SAB	100ul	EUR 252

CES1 Antibody
1-CSB-PA005258GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against CES1. Recognizes CES1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC

CES1 Antibody
1-CSB-PA005258LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CES1. Recognizes CES1 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:5000, IHC:1:20-1:200, IF:1:50-1:200

CES1 Antibody
DF6661	Affbiotech	200ul	EUR 304
Description: CES1 Antibody detects endogenous levels of total CES1.

CES1 siRNA
20-abx911562	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CES1 siRNA
20-abx911563	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

CES1 Antibody
ABD6661	Lifescience Market	100 ug	EUR 438

mRNAExpress mRNA Synthesis kit (5 reactions)
MR-KIT-1	SBI	5 reactions	EUR 1152
Category: Stem Cell Products

Carboxylesterase 1 Blocking Peptide
33R-1397	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CES1 antibody, catalog no. 70R-1223

Carboxylesterase 1 Blocking Peptide
33R-9660	Fitzgerald	100 ug	EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of CES1 antibody, catalog no. 70R-1213

anti-Liver Carboxylesterase 1
YF-PA10902	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Liver Carboxylesterase 1

anti-Liver Carboxylesterase 1
YF-PA10903	Abfrontier	100 ug	EUR 403
Description: Rabbit polyclonal to Liver Carboxylesterase 1

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN320A-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)
PIN340iPS-KIT	SBI	1 Kit	EUR 4941
Category: PinPoint Integrase Tools

Human CES5A/ Carboxylesterase 5A ELISA Kit
E0476Hu	Sunlong	1 Kit	EUR 605

Mouse Carboxylesterase 3(CES3) ELISA kit
E03C1625-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxylesterase 3(CES3) ELISA kit
E03C1625-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Carboxylesterase 3(CES3) ELISA kit
E03C1625-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxylesterase 3(CES3) ELISA kit
E06C1625-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxylesterase 3(CES3) ELISA kit
E06C1625-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Carboxylesterase 3(CES3) ELISA kit
E06C1625-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxylesterase 3(CES3) ELISA kit
E04C1625-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxylesterase 3(CES3) ELISA kit
E04C1625-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Carboxylesterase 3(CES3) ELISA kit
E04C1625-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxylesterase 3(CES3) ELISA kit
E01C1625-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxylesterase 3(CES3) ELISA kit
E01C1625-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxylesterase 3(CES3) ELISA kit
E01C1625-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxylesterase 3(CES3) ELISA kit
E07C1625-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxylesterase 3(CES3) ELISA kit
E07C1625-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Carboxylesterase 3(CES3) ELISA kit
E07C1625-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Carboxylesterase 2 (CES2) ELISA Kit
20-abx156913	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Mouse Carboxylesterase 5A (CES5A) ELISA Kit
abx255136-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Human Carboxylesterase 2 (CES2) ELISA Kit
20-abx258756	Abbexa	EUR 7112.00 EUR 3792.00 EUR 879.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Carboxylesterase 5A (CES5A) ELISA Kit
abx251720-96tests	Abbexa	96 tests	EUR 739
Shipped within 5-12 working days.

Monkey Carboxylesterase 3(CES3) ELISA kit
E09C1625-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxylesterase 3(CES3) ELISA kit
E09C1625-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Carboxylesterase 3(CES3) ELISA kit
E09C1625-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human CES5A(Carboxylesterase 5A) ELISA Kit
EH2362	FN Test	96T	EUR 567.6
Detection range: 78-5000 pg/ml Uniprot ID: Q6NT32 Alias: CES5A/CES7/Cauxin/Carboxylesterase-like urinary excreted protein homolog
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 46.9pg/ml

ELISA kit for Mouse Carboxylesterase 5A
EK4755	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Mouse Carboxylesterase 5A in samples from serum, plasma, tissue homogenates and other biological fluids.

ELISA kit for Human Carboxylesterase 5A
EK4756	SAB	96 tests	EUR 670
Description: Enzyme-linked immunosorbent assay kit for quantification of Human Carboxylesterase 5A in samples from serum, plasma, tissue homogenates and other biological fluids.

Dog Carboxylesterase 3(CES3) ELISA kit
E08C1625-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxylesterase 3(CES3) ELISA kit
E08C1625-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Carboxylesterase 3(CES3) ELISA kit
E08C1625-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Ces5a/ Carboxylesterase 5A ELISA Kit
E1624Mo	Sunlong	1 Kit	EUR 632

Bovine Carboxylesterase 4A, CES4A ELISA KIT
ELI-09958b	Lifescience Market	96 Tests	EUR 928

Mouse Carboxylesterase 3, Ces3 ELISA KIT
ELI-25503m	Lifescience Market	96 Tests	EUR 865

Human Carboxylesterase 5A, CES5A ELISA KIT
ELI-26914h	Lifescience Market	96 Tests	EUR 824

Mouse Carboxylesterase 5A, Ces5a ELISA KIT
ELI-26955m	Lifescience Market	96 Tests	EUR 865

Human Carboxylesterase 3, CES3 ELISA KIT
ELI-27351h	Lifescience Market	96 Tests	EUR 824

Human Carboxylesterase 4A, CES4A ELISA KIT
ELI-27352h	Lifescience Market	96 Tests	EUR 824

Mouse Carboxylesterase 4A, Ces4a ELISA KIT
ELI-08324m	Lifescience Market	96 Tests	EUR 865

Dog Carboxylesterase 5A (CES5A) ELISA Kit
abx520651-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Human Carboxylesterase 3 (CES3) ELISA Kit
abx386480-96tests	Abbexa	96 tests	EUR 911
Shipped within 5-12 working days.

Mouse Ces5a( Carboxylesterase 5A) ELISA Kit
EM0788	FN Test	96T	EUR 567.6
Detection range: 0.312-20 ng/ml Uniprot ID: Q6AW46 Alias: Ces5a/CES5A/CES7/Cauxin/Carboxylesterase-like urinary excreted protein homolog
Description: Method of detection: Coated with Antigen, Competitive ELISA;Reacts with: Mus ;Sensitivity: 0.188 ng/ml

Human Carboxylesterase 2 ELISA Kit (CES2)
RK01089	Abclonal	96 Tests	EUR 521

Human Carboxylesterase 2 (CES2) ELISA Kit
SEF282Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 2 (CES2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 2 (CES2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 2 (CES2) ELISA Kit
SEF282Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 2 (CES2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 2 (CES2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 2 (CES2) ELISA Kit
SEF282Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 2 (CES2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 2 (CES2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 2 (CES2) ELISA Kit
SEF282Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Carboxylesterase 2 (CES2) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Carboxylesterase 2 (CES2) in serum, plasma, tissue homogenates and other biological fluids.

Human Carboxylesterase 2 (CES2) ELISA Kit
4-SEF282Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Carboxylesterase 2 elisa. Alternative names of the recognized antigen: CE-2 CES2A1 PCE-2 iCE Intestine, Liver Methylumbelliferyl-acetate deacetylase 2 Cocaine esterase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Carboxylesterase 2 (CES2) in samples from serum, plasma, tissue homogenates and other biological fluids with no significant corss-reactivity with analogues from other species.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody
EXOAB-KIT-1	SBI	25 ul each	EUR 627
Category: Exosomes

Ces5a ELISA Kit| Mouse Carboxylesterase 5A ELISA Kit
EF013398	Lifescience Market	96 Tests	EUR 689

CES1 Blocking Peptide
DF6661-BP	Affbiotech	1mg	EUR 195

CES1 Conjugated Antibody
C32472	SAB	100ul	EUR 397

CES1 cloning plasmid
CSB-CL005258HU-10ug	Cusabio	10ug	EUR 376
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1701 Sequence: atgtggctccctgctcttgtcctggccactctcgctgcttccgcggcttgggggcatccgtcctcgccacctgtggtggacaccgtgcatggcaaagtgctggggaagttcgtcagcttagaaggatttgcacagcctgtggccattttcctgggaatcccttttgccaagccgc Show more
Description: A cloning plasmid for the CES1 gene.

CES1 Polyclonal Antibody
A62258	EpiGentek	100 µg	EUR 570.55
Description: reagents widely cited

CES1 Rabbit pAb
A1853-100ul	Abclonal	100 ul	EUR 308

CES1 Rabbit pAb
A1853-200ul	Abclonal	200 ul	EUR 459

CES1 Rabbit pAb
A1853-20ul	Abclonal	20 ul	EUR 183

CES1 Rabbit pAb
A1853-50ul	Abclonal	50 ul	EUR 223

anti- CES1 antibody
FNab01615	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:500 - 1:2000 IHC: 1:50 - 1:200 Immunogen: carboxylesterase 1 (monocyte/macrophage serine esterase 1) Uniprot ID: P23141 Gene ID: 1066 Research Area: Cardiovascular, Metabolism
Description: Antibody raised against CES1

Anti-CES1 antibody
PAab01615	Lifescience Market	100 ug	EUR 355

Anti-CES1 antibody
STJ23100	St John's Laboratory	100 µl	EUR 277
Description: This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They may participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This enzyme is the major liver enzyme and functions in liver drug clearance. Mutations of this gene cause carboxylesterase 1 deficiency. Three transcript variants encoding three different isoforms have been found for this gene.

Anti-CES1 antibody
STJ71501	St John's Laboratory	100 µg	EUR 359

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN300A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

Rat TIMP-1 AssayMax ELISA Kit
ERT2538-1	AssayPro	96 Well Plate	EUR 477

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)
CAS510A-KIT	SBI	1 Kit	EUR 805
Category: Cas9

Liver Carboxylesterase 1 Rabbit mAb
A11478-100ul	Abclonal	100 ul	EUR 410

Liver Carboxylesterase 1 Rabbit mAb
A11478-200ul	Abclonal	200 ul	EUR 571

Liver Carboxylesterase 1 Rabbit mAb
A11478-20ul	Abclonal	20 ul	EUR 221

Liver Carboxylesterase 1 Rabbit mAb
A11478-50ul	Abclonal	50 ul	EUR 287

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN400A-KIT	SBI	1 Kit	EUR 2798
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN410A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)
PIN412A-KIT	SBI	1 Kit	EUR 4335
Category: PinPoint Integrase Tools

Guinea pig Carboxylesterase 3(CES3) ELISA kit
E05C1625-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Carboxylesterase 3(CES3) ELISA kit
E05C1625-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Carboxylesterase 3(CES3) ELISA kit
E05C1625-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Carboxylesterase 3(CES3) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Liver carboxylesterase 22, Es22 ELISA KIT
ELI-30723m	Lifescience Market	96 Tests	EUR 865

Mouse Liver carboxylesterase 31, Es31 ELISA KIT
ELI-30724m	Lifescience Market	96 Tests	EUR 865

Mouse Liver carboxylesterase N, Es1 ELISA KIT
ELI-30725m	Lifescience Market	96 Tests	EUR 865

Rabbit Liver carboxylesterase 2, CES2 ELISA KIT
ELI-27350Ra	Lifescience Market	96 Tests	EUR 928

ELISA kit for Human CES2 (Carboxylesterase 2)
ELK5225	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Carboxylesterase 2 (CES2). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Carboxyl Show more
Description: A sandwich ELISA kit for detection of Carboxylesterase 2 from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Human Carboxylesterase 2 (CES2)
KTE62570-48T	Abbkine	48T	EUR 354
Carboxylesterase 2 is a member of a large multigene family. The enzymes encoded by these genes are responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and heroin. They also hydrolyze long-chain fatty acid esters a Show more
Description: Quantitative sandwich ELISA for measuring Human Carboxylesterase 2 (CES2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Carboxylesterase 2 (CES2)
KTE62570-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2252
Carboxylesterase 2 is a member of a large multigene family. The enzymes encoded by these genes are responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and heroin. They also hydrolyze long-chain fatty acid esters a Show more
Description: Quantitative sandwich ELISA for measuring Human Carboxylesterase 2 (CES2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Carboxylesterase 2 (CES2)
KTE62570-96T	Abbkine	96T	EUR 572
Carboxylesterase 2 is a member of a large multigene family. The enzymes encoded by these genes are responsible for the hydrolysis of ester- and amide-bond-containing drugs such as cocaine and heroin. They also hydrolyze long-chain fatty acid esters a Show more
Description: Quantitative sandwich ELISA for measuring Human Carboxylesterase 2 (CES2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS
AP-STR-KIT-1	CORNING	1/pk	EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Carboxylesterase 2 antibody
70R-3529	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Carboxylesterase 2 antibody

Carboxylesterase 2 antibody
70R-3941	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Carboxylesterase 2 antibody

Carboxylesterase 7 antibody
70R-5468	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Carboxylesterase 7 antibody raised against the N terminal of CES7

Carboxylesterase 7 antibody
70R-5469	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal Carboxylesterase 7 antibody raised against the middle region of CES7

CES1 Antibody, HRP conjugated
1-CSB-PA005258LB01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CES1. Recognizes CES1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

CES1 Antibody, FITC conjugated
1-CSB-PA005258LC01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against CES1. Recognizes CES1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

Rat CES1(Carboxylesterase 1) ELISA Kit