Rat DCX(Doublecortin) ELISA Kit

Rat DCX(Doublecortin) ELISA Kit

Rat Doublecortin (DCX) ELISA Kit

RD-DCX-Ra-48Tests 48 Tests
EUR 557

Rat Doublecortin (DCX) ELISA Kit

RD-DCX-Ra-96Tests 96 Tests
EUR 775

Human Doublecortin (DCX) ELISA Kit

DLR-DCX-Hu-48T 48T
EUR 517
  • Should the Human Doublecortin (DCX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Doublecortin (DCX) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Doublecortin (DCX) ELISA Kit

DLR-DCX-Hu-96T 96T
EUR 673
  • Should the Human Doublecortin (DCX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Doublecortin (DCX) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Doublecortin (DCX) ELISA Kit

DLR-DCX-Mu-48T 48T
EUR 527
  • Should the Mouse Doublecortin (DCX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Doublecortin (DCX) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Doublecortin (DCX) ELISA Kit

DLR-DCX-Mu-96T 96T
EUR 688
  • Should the Mouse Doublecortin (DCX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Doublecortin (DCX) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Doublecortin (DCX) ELISA Kit

RDR-DCX-Hu-48Tests 48 Tests
EUR 544

Human Doublecortin (DCX) ELISA Kit

RDR-DCX-Hu-96Tests 96 Tests
EUR 756

Mouse Doublecortin (DCX) ELISA Kit

RDR-DCX-Mu-48Tests 48 Tests
EUR 557

Mouse Doublecortin (DCX) ELISA Kit

RDR-DCX-Mu-96Tests 96 Tests
EUR 774

Human Doublecortin (DCX) ELISA Kit

RD-DCX-Hu-48Tests 48 Tests
EUR 521

Human Doublecortin (DCX) ELISA Kit

RD-DCX-Hu-96Tests 96 Tests
EUR 723

Mouse Doublecortin (DCX) ELISA Kit

RD-DCX-Mu-48Tests 48 Tests
EUR 533

Mouse Doublecortin (DCX) ELISA Kit

RD-DCX-Mu-96Tests 96 Tests
EUR 740

Rat Doublecortin (DCX) ELISA Kit

20-abx155452
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Doublecortin (DCX) ELISA Kit

SEC442Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Doublecortin (DCX) in Tissue homogenates and other biological fluids.

Rat Doublecortin (DCX) ELISA Kit

SEC442Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Doublecortin (DCX) in Tissue homogenates and other biological fluids.

Rat Doublecortin (DCX) ELISA Kit

SEC442Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Doublecortin (DCX) in Tissue homogenates and other biological fluids.

Rat Doublecortin (DCX) ELISA Kit

SEC442Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Doublecortin (DCX) in Tissue homogenates and other biological fluids.

Rat Doublecortin (DCX) ELISA Kit

4-SEC442Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Doublecortin elisa. Alternative names of the recognized antigen: DBCN
  • DC
  • LISX
  • SCLH
  • XLIS
  • Doublin
  • Doublecortex
  • Lissencephalin-X
  • Lissencephaly, X-Linked
  • Neuronal migration protein doublecortin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Doublecortin (DCX) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

DCX/Doublecortin

CH23033 100 ul
EUR 179

Doublecortin/DCX

MO22113 100 ul
EUR 435

ELISA kit for Rat DCX (Doublecortin)

ELK6474 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Doublecortin (DCX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Doublecortin (D
  • Show more
Description: A sandwich ELISA kit for detection of Doublecortin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Doublecortin (DCX) CLIA Kit

20-abx493699
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Doublecortin (DCX) Protein

20-abx653211
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Pig Doublecortin (DCX) ELISA Kit

abx360556-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Rabbit Doublecortin (DCX) ELISA Kit

abx363566-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human DCX(Doublecortin) ELISA Kit

EH2939 96T
EUR 524.1
  • Detection range: 0.156-10 ng/ml
  • Uniprot ID: O43602
  • Alias: DCX/Doublecortin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Doublecortin (DCX) ELISA Kit

20-abx153925
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Human Doublecortin (DCX) ELISA Kit

20-abx151342
  • EUR 7378.00
  • EUR 3933.00
  • EUR 911.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Sheep Doublecortin (DCX) ELISA Kit

abx364603-96tests 96 tests
EUR 926
  • Shipped within 5-12 working days.

Monkey Doublecortin (DCX) ELISA Kit

abx359063-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Chicken Doublecortin (DCX) ELISA Kit

abx355566-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Doublecortin (DCX) ELISA Kit

abx252326-96tests 96 tests
EUR 707
  • Shipped within 5-12 working days.

Human Doublecortin (DCX) ELISA Kit

SEC442Hu-10x96wellstestplate 10x96-wells test plate
EUR 4731.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Doublecortin (DCX) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Doublecortin (DCX) ELISA Kit

SEC442Hu-1x48wellstestplate 1x48-wells test plate
EUR 477.3
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Doublecortin (DCX) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Doublecortin (DCX) ELISA Kit

SEC442Hu-1x96wellstestplate 1x96-wells test plate
EUR 639
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Doublecortin (DCX) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Doublecortin (DCX) ELISA Kit

SEC442Hu-5x96wellstestplate 5x96-wells test plate
EUR 2575.5
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Doublecortin (DCX) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Doublecortin (DCX) ELISA Kit

4-SEC442Hu
  • EUR 4782.00
  • EUR 2526.00
  • EUR 640.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Doublecortin elisa. Alternative names of the recognized antigen: DBCN
  • DC
  • LISX
  • SCLH
  • XLIS
  • Doublin
  • Doublecortex
  • Lissencephalin-X
  • Lissencephaly, X-Linked
  • Neuronal migration protein doublecortin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Doublecortin (DCX) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Doublecortin (DCX) ELISA Kit

SEC442Mu-10x96wellstestplate 10x96-wells test plate
EUR 4862.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Doublecortin (DCX) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Doublecortin (DCX) ELISA Kit

SEC442Mu-1x48wellstestplate 1x48-wells test plate
EUR 488.08
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Doublecortin (DCX) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Doublecortin (DCX) ELISA Kit

SEC442Mu-1x96wellstestplate 1x96-wells test plate
EUR 654.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Doublecortin (DCX) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Doublecortin (DCX) ELISA Kit

SEC442Mu-5x96wellstestplate 5x96-wells test plate
EUR 2644.8
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Doublecortin (DCX) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Doublecortin (DCX) ELISA Kit

4-SEC442Mu
  • EUR 4913.00
  • EUR 2595.00
  • EUR 655.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Doublecortin elisa. Alternative names of the recognized antigen: DBCN
  • DC
  • LISX
  • SCLH
  • XLIS
  • Doublin
  • Doublecortex
  • Lissencephalin-X
  • Lissencephaly, X-Linked
  • Neuronal migration protein doublecortin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Doublecortin (DCX) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Doublecortin ELISA Kit (DCX)

RK01252 96 Tests
EUR 521

Doublecortin (DCX) Antibody

20-abx119035
  • EUR 314.00
  • EUR 98.00
  • EUR 398.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 200 ug
  • 300 µg
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody

20-abx112164
  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody

20-abx129883
  • EUR 439.00
  • EUR 133.00
  • EUR 1233.00
  • EUR 592.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Doublecortin (DCX) Antibody

20-abx000574
  • EUR 411.00
  • EUR 592.00
  • 100 ul
  • 200 ul
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody

20-abx001048
  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody

abx010988-100ug 100 ug
EUR 411
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody

abx031696-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody

abx031696-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody

20-abx172159
  • EUR 857.00
  • EUR 439.00
  • 1 mg
  • 200 ug
  • Please enquire.

Doublecortin (DCX) Antibody

20-abx172160
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Doublecortin (DCX) Antibody

20-abx176199
  • EUR 1205.00
  • EUR 578.00
  • 1 mg
  • 200 ug
  • Please enquire.

Doublecortin (DCX) Antibody

20-abx176200
  • EUR 1233.00
  • EUR 592.00
  • 1 mg
  • 200 ug
  • Please enquire.

Doublecortin (DCX) Antibody

20-abx176201
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Doublecortin (DCX) Antibody

20-abx327058
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody

20-abx328221
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody

abx332188-100ul 100 ul
EUR 425
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody

20-abx318342
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody

abx431201-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Doublecortin (DCX) Antibody

abx430931-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Doublecortin (DCX) Antibody

20-abx301172
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody

abx232280-100ug 100 ug
EUR 481
  • Shipped within 5-12 working days.

Recombinant Doublecortin (DCX)

4-RPC442Mu01
  • EUR 492.45
  • EUR 235.00
  • EUR 1571.68
  • EUR 590.56
  • EUR 1081.12
  • EUR 392.00
  • EUR 3779.20
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: O88809
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.3kDa
  • Isoelectric Point: Inquire
Description: Recombinant Mouse Doublecortin expressed in: E.coli

ELISA kit for Human DCX (Doublecortin)

E-EL-H2033 1 plate of 96 wells
EUR 534
  • Gentaur's DCX ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DCX. Standards or samples are added to the micro ELISA plate wells and combined with the
  • Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DCX (Doublecortin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human DCX (Doublecortin)

ELK2898 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Doublecortin (DCX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Doublecortin (D
  • Show more
Description: A sandwich ELISA kit for detection of Doublecortin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse DCX (Doublecortin)

ELK6420 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Doublecortin (DCX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Doublecortin (D
  • Show more
Description: A sandwich ELISA kit for detection of Doublecortin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Doublecortin (DCX) ELISA Kit

abx357983-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Doublecortin (DCX) CLIA Kit

abx196616-96tests 96 tests
EUR 825
  • Shipped within 5-12 working days.

Human Doublecortin (DCX) CLIA Kit

20-abx493697
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Mouse Doublecortin (DCX) CLIA Kit

20-abx493698
  • EUR 7973.00
  • EUR 4246.00
  • EUR 981.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Human Doublecortin (DCX) Protein

20-abx653209
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Mouse Doublecortin (DCX) Protein

20-abx167310
  • EUR 690.00
  • EUR 286.00
  • EUR 2124.00
  • EUR 815.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Doublecortin (DCX) Antibody (HRP)

20-abx303593
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody (FITC)

20-abx303594
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody (Biotin)

20-abx303595
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody (HRP)

20-abx303596
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody (FITC)

20-abx303597
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Doublecortin (DCX) Antibody (Biotin)

20-abx303598
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Anti-Doublecortin/DCX Antibody

A01053-1 100ug/vial
EUR 294

CLIA kit for Human DCX (Doublecortin)

E-CL-H1230 1 plate of 96 wells
EUR 584
  • Gentaur's DCX CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human DCX . Standards or samples are added to the micro CLIA plate wells and combined with the sp
  • Show more
Description: A sandwich CLIA kit for quantitative measurement of Human DCX (Doublecortin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat Neuronal migration protein doublecortin (DCX)

KTE100787-48T 48T
EUR 332
  • DCX encodes a member of the doublecortin family. The protein encoded by DCX is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Neuronal migration protein doublecortin (DCX)

KTE100787-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DCX encodes a member of the doublecortin family. The protein encoded by DCX is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Neuronal migration protein doublecortin (DCX)

KTE100787-96T 96T
EUR 539
  • DCX encodes a member of the doublecortin family. The protein encoded by DCX is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Doublecortin (DCX) Polyclonal Antibody (Mouse)

4-PAC442Mu01
  • EUR 251.00
  • EUR 2576.00
  • EUR 640.00
  • EUR 316.00
  • EUR 215.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCX (Met1~Met366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX)

Anti-Doublecortin/DCX Monoclonal Antibody

M01053-1 100ul
EUR 397
Description: Anti-Doublecortin/DCX Monoclonal Antibody tested in WB, IF, ICC, IHC, reactive to Human, Rat, Mouse

Mouse Neuronal migration protein doublecortin, Dcx ELISA KIT

ELI-26363m 96 Tests
EUR 865

Human Neuronal migration protein doublecortin, DCX ELISA KIT

ELI-26527h 96 Tests
EUR 824

Dcx/ Rat Dcx ELISA Kit

ELI-48383r 96 Tests
EUR 886

Doublecortin Phospho-Ser376 (DCX pS376) Antibody

20-abx326624
  • EUR 314.00
  • EUR 244.00
  • 100 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Neuronal migration protein doublecortin (DCX)

1-CSB-EP006576HU
  • EUR 505.00
  • EUR 265.00
  • EUR 1827.00
  • EUR 766.00
  • EUR 1218.00
  • EUR 335.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 65.3 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Neuronal migration protein doublecortin(DCX) expressed in E.coli

Doublecortin (DCX) Polyclonal Antibody (Mouse), APC

4-PAC442Mu01-APC
  • EUR 351.00
  • EUR 3365.00
  • EUR 935.00
  • EUR 449.00
  • EUR 222.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCX (Met1~Met366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with APC.

Doublecortin (DCX) Polyclonal Antibody (Mouse), Biotinylated

4-PAC442Mu01-Biotin
  • EUR 316.00
  • EUR 2526.00
  • EUR 744.00
  • EUR 387.00
  • EUR 221.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCX (Met1~Met366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with Biotin.

Doublecortin (DCX) Polyclonal Antibody (Mouse), Cy3

4-PAC442Mu01-Cy3
  • EUR 427.00
  • EUR 4445.00
  • EUR 1205.00
  • EUR 557.00
  • EUR 254.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCX (Met1~Met366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with Cy3.

Doublecortin (DCX) Polyclonal Antibody (Mouse), FITC

4-PAC442Mu01-FITC
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCX (Met1~Met366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with FITC.

Doublecortin (DCX) Polyclonal Antibody (Mouse), HRP

4-PAC442Mu01-HRP
  • EUR 321.00
  • EUR 2933.00
  • EUR 827.00
  • EUR 405.00
  • EUR 209.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCX (Met1~Met366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with HRP.

Doublecortin (DCX) Polyclonal Antibody (Mouse), PE

4-PAC442Mu01-PE
  • EUR 301.00
  • EUR 2712.00
  • EUR 768.00
  • EUR 379.00
  • EUR 197.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCX (Met1~Met366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with PE.

Anti-DCX/Doublecortin Rabbit Monoclonal Antibody

M01053 100ug/vial
EUR 397
Description: Rabbit Monoclonal DCX/Doublecortin Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-Doublecortin / DCX (aa232-242) antibody

STJ72521 100 µg
EUR 359

Anti-Doublecortin / DCX (aa69-81) antibody

STJ73603 100 µg
EUR 359

ELISA kit for Mouse Neuronal migration protein doublecortin (DCX)

KTE71322-48T 48T
EUR 332
  • Doublecortin encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long dist
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Neuronal migration protein doublecortin (DCX)

KTE71322-5platesof96wells 5 plates of 96 wells
EUR 2115
  • Doublecortin encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long dist
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Neuronal migration protein doublecortin (DCX)

KTE71322-96T 96T
EUR 539
  • Doublecortin encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long dist
  • Show more
Description: Quantitative sandwich ELISA for measuring Mouse Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Neuronal migration protein doublecortin (DCX)

KTE62125-48T 48T
EUR 332
  • DCX encodes a member of the doublecortin family. The protein encoded by DCX is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Neuronal migration protein doublecortin (DCX)

KTE62125-5platesof96wells 5 plates of 96 wells
EUR 2115
  • DCX encodes a member of the doublecortin family. The protein encoded by DCX is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Neuronal migration protein doublecortin (DCX)

KTE62125-96T 96T
EUR 539
  • DCX encodes a member of the doublecortin family. The protein encoded by DCX is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach
  • Show more
Description: Quantitative sandwich ELISA for measuring Human Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Monoclonal Doublecortin (DCX) Antibody, Clone: 3 e1

AMM05839G 0.1ml
EUR 528
Description: A Monoclonal antibody against Human Doublecortin (DCX). The antibodies are raised in Mouse and are from clone 3 e1. This antibody is applicable in IF, WB

Doublecortin (DCX) Polyclonal Antibody (Mouse), APC-Cy7

4-PAC442Mu01-APC-Cy7
  • EUR 583.00
  • EUR 6610.00
  • EUR 1750.00
  • EUR 778.00
  • EUR 324.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: DCX (Met1~Met366)
  • Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with APC-Cy7.

Human Doublecortin (DCX) Differentiation Reporter (pGreenZeo, Plasmid)

SR10041PA-1 10 ug
EUR 1749
  • Category: Stem Cell Products

Human Doublecortin (DCX) Differentiation Reporter (pGreenZeo, Virus)

SR10041VA-1 >2 x 10^6 IFUs
EUR 755
  • Category: Stem Cell Products

Rat DCX ELISA Kit

ERD0155 96Tests
EUR 521

Rat Doublecortin ELISA kit

E02D0148-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Doublecortin ELISA kit

E02D0148-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Doublecortin ELISA kit

E02D0148-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monoclonal DCX / Doublecortin Antibody (clone 2G5), Clone: 2G5

APR11711G 0.05mg
EUR 484
Description: A Monoclonal antibody against Human DCX / Doublecortin (clone 2G5). The antibodies are raised in Mouse and are from clone 2G5. This antibody is applicable in WB and IHC-P, IF, ICC, E, Flo

Polyclonal Doublecortin / DCX (aa232-242) Antibody (internal region)

AMM05841G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Doublecortin / DCX (aa232-242) (internal region). This antibody is tested and proven to work in the following applications:

DCX ELISA Kit (Rat) (OKDD00742)

OKDD00742 96 Wells
EUR 1040
Description: Description of target: This gene encodes a member of the doublecortin family. the protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. in the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. the encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. studies in knockout mice lacking this gene suggest that this gene has a cortical role in nuclear translocation and positioning of the mitotic spindle in radial glial mitotic division. this gene is essential for neuronal migration, differentiation, and plasticity, is required for hippocampal development and also plays a role in dendrites development.;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.054 ng/mL

Control/Blocking peptide for Mouse Neuronal migration protein doublecortin (DCX)

DCX11-C 100 ug
EUR 164

Human DCX ELISA Kit

EHD0155 96Tests
EUR 521

Goat DCX ELISA Kit

EGTD0155 96Tests
EUR 521

Canine DCX ELISA Kit

ECD0155 96Tests
EUR 521

Chicken DCX ELISA Kit

ECKD0155 96Tests
EUR 521

Bovine DCX ELISA Kit

EBD0155 96Tests
EUR 521

Anserini DCX ELISA Kit

EAD0155 96Tests
EUR 521

DCX ELISA KIT|Human

EF006756 96 Tests
EUR 689

Porcine DCX ELISA Kit

EPD0155 96Tests
EUR 521

Rabbit DCX ELISA Kit

ERTD0155 96Tests
EUR 521

Sheep DCX ELISA Kit

ESD0155 96Tests
EUR 521

Mouse DCX ELISA Kit

EMD0155 96Tests
EUR 521

Monkey DCX ELISA Kit

EMKD0155 96Tests
EUR 521

Doublecortin Cell ELISA Kit

abx595182-96tests 96 tests
EUR 637
  • Shipped within 1-2 weeks.

Goat Doublecortin ELISA kit

E06D0148-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Doublecortin ELISA kit

E06D0148-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Doublecortin ELISA kit

E06D0148-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Doublecortin ELISA kit

E01D0148-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Doublecortin ELISA kit

E01D0148-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Doublecortin ELISA kit

E01D0148-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Doublecortin ELISA kit

E03D0148-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Doublecortin ELISA kit

E03D0148-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Doublecortin ELISA kit

E03D0148-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Doublecortin ELISA kit

E04D0148-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Doublecortin ELISA kit

E04D0148-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Doublecortin ELISA kit

E04D0148-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Doublecortin ELISA kit

E08D0148-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Doublecortin ELISA kit

E08D0148-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Doublecortin ELISA kit

E08D0148-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Doublecortin ELISA kit

E09D0148-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Doublecortin ELISA kit

E09D0148-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Doublecortin ELISA kit

E09D0148-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Doublecortin ELISA kit

E07D0148-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Doublecortin ELISA kit

E07D0148-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Doublecortin ELISA kit

E07D0148-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Guinea Pig DCX ELISA Kit

EGD0155 96Tests
EUR 521

DCX ELISA Kit (Human) (OKCD01675)

OKCD01675 96 Wells
EUR 831
Description: Description of target: Microtubule-associated protein required for initial steps of neuronal dispersion and cortex lamination during cerebral cortex development. May act by competing with the putative neuronal protein kinase DCLK1 in binding to a target protein. May in that way participate in a signaling pathway that is crucial for neuronal interaction before and during migration, possibly as part of a calcium ion-dependent signal transduction pathway. May be part with PAFAH1B1/LIS-1 of overlapping, but distinct, signaling pathways that promote neuronal migration.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

DCX ELISA Kit (Human) (OKAN04745)

OKAN04745 96 Wells
EUR 792
Description: Description of target: This gene encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. The encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. In addition, the encoded protein interacts with LIS1, the regulatory gamma subunit of platelet activating factor acetylhydrolase, and this interaction is important to proper microtubule function in the developing cortex. Mutations in this gene cause abnormal migration of neurons during development and disrupt the layering of the cortex, leading to epilepsy, cognitive disability, subcortical band heterotopia ("double cortex" syndrome) in females and lissencephaly ("smooth brain" syndrome) in males. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

DCX ELISA Kit (Mouse) (OKCD08134)

OKCD08134 96 Wells
EUR 1001
Description: Description of target: This gene encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. The encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. In addition, the encoded protein interacts with LIS1, the regulatory gamma subunit of platelet activating factor acetylhydrolase. Studies in knockout mice lacking this gene and the LIS1 gene suggest that the molecular interaction of these two genes is important in both in neuronal migration and neurogenesis, and there is a cortical role of this gene in nuclear translocation and positioning of the mitotic spindle in radial glial mitotic division. Multiple transcript variants encoding three different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

DCX ELISA Kit (Mouse) (OKDD00730)

OKDD00730 96 Wells
EUR 988
Description: Description of target: This gene encodes a member of the doublecortin family. the protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. in the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. the encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. in addition, the encoded protein interacts with lis1, the regulatory gamma subunit of platelet activating factor acetylhydrolase. studies in knockout mice lacking this gene and the lis1 gene suggest that the molecular interaction of these two genes is important in both in neuronal migration and neurogenesis, and there is a cortical role of this gene in nuclear translocation and positioning of the mitotic spindle in radial glial mitotic division. multiple transcript variants encoding three different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.051 ng/mL

Guinea pig Doublecortin ELISA kit

E05D0148-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Doublecortin ELISA kit

E05D0148-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Doublecortin ELISA kit

E05D0148-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit anti-Mouse Neuronal migration protein doublecortin (anti-DCX) IgG, affinity pure

DCX11-A 100 ug
EUR 457

DCX Recombinant Protein (Rat)

RP197522 100 ug Ask for price

Doublecortin Colorimetric Cell-Based ELISA Kit

EKC1174 100ul
EUR 572

DCX Antibody

BF0083 200ul
EUR 376
Description: DCX antibody detects endogenous levels of total DCX.

DCX siRNA

20-abx913723
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DCX siRNA

20-abx913724
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

DCX antibody

70R-5900 50 ug
EUR 467
Description: Rabbit polyclonal DCX antibody

DCX antibody

70R-5901 50 ug
EUR 467
Description: Rabbit polyclonal DCX antibody

DCX Antibody

ABD6268 100 ug
EUR 438

DCX antibody

38200-100ul 100ul
EUR 252

DCX Antibody

43298-100ul 100ul
EUR 252

DCX antibody

10R-8358 100 ul
EUR 392
Description: Mouse monoclonal DCX antibody

DCX antibody

10R-3812 100 ul
EUR 726
Description: Mouse monoclonal DCX antibody

DCX antibody

70R-16767 50 ul
EUR 435
Description: Rabbit polyclonal DCX antibody

DCX Antibody

DF6268 200ul
EUR 304
Description: DCX Antibody detects endogenous levels of total DCX.

DCX Antibody

1-CSB-PA007685
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DCX. Recognizes DCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

DCX Antibody

1-CSB-PA007687
  • EUR 222.00
  • EUR 195.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DCX. Recognizes DCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

DCX Antibody

1-CSB-PA006576DA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCX. Recognizes DCX from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

DCX Antibody

1-CSB-PA006576GA01HU
  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DCX. Recognizes DCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DCX Antibody

1-CSB-PA006576LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCX. Recognizes DCX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DCX Antibody

CSB-PA189299-
EUR 335
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against DCX. Recognizes DCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

DCX Antibody

CSB-PA189299-100ul 100ul
EUR 316
  • Form: liquid
  • Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo
  • Show more
Description: A polyclonal antibody against DCX. Recognizes DCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

Doublecortin Antibody

AF7627 200ul
EUR 376
Description: Doublecortin Antibody detects endogenous levels of Doublecortin.

Doublecortin antibody

70R-36595 100 ug
EUR 327
Description: Rabbit polyclonal Doublecortin antibody

Doublecortin antibody

70R-34503 100 ug
EUR 327
Description: Rabbit polyclonal Doublecortin antibody

Doublecortin Antibody

ABD7608 100 ug
EUR 438

Doublecortin Antibody

49313-100ul 100ul
EUR 333

Doublecortin Antibody

49313-50ul 50ul
EUR 239

Doublecortin Antibody

21630-100ul 100ul
EUR 252

Doublecortin Antibody

21630-50ul 50ul
EUR 187

Doublecortin antibody

20R-2739 50 ug
EUR 281
Description: Rabbit polyclonal Doublecortin antibody

Doublecortin Antibody

DF7608 200ul
EUR 304
Description: Doublecortin Antibody detects endogenous levels of total Doublecortin.

anti-Doublecortin

YF-PA11304 50 ug
EUR 363
Description: Mouse polyclonal to Doublecortin

Dcx ORF Vector (Rat) (pORF)

ORF065842 1.0 ug DNA
EUR 506

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Doublecortin Colorimetric Cell-Based ELISA Kit (OKAG00672)

OKAG00672 96 Wells
EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based
Subtype: None
Detection Method: Colorimetric 450 nm;Sensitivity:

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

DCX Conjugated Antibody

C38200 100ul
EUR 397

DCX Conjugated Antibody

C43298 100ul
EUR 397

DCX Blocking Peptide

BF0083-BP 1mg
EUR 195

DCX cloning plasmid

CSB-CL006576HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1083
  • Sequence: atggaacttgattttggacactttgacgaaagagataagacatccaggaacatgcgaggctcccggatgaatgggttgcctagccccactcacagcgcccactgtagcttctaccgaaccagaaccttgcaggcactgagtaatgagaagaaagccaagaaggtacgtttctacc
  • Show more
Description: A cloning plasmid for the DCX gene.

anti- DCX antibody

FNab02280 100µg
EUR 505.25
  • Recommended dilution: WB: 1:200-1:2000
  • Immunogen: doublecortin
  • Uniprot ID: O43602
  • Gene ID: 1641
  • Research Area: Neuroscience, Stem Cells, Signal Transduction, Developmental biology
Description: Antibody raised against DCX

Doublecortex (DCX) Antibody

abx433506-200ul 200 ul
EUR 453
  • Shipped within 1-3 working days.

DCX Rabbit pAb

A0149-100ul 100 ul
EUR 308

DCX Rabbit pAb

A0149-200ul 200 ul
EUR 459

DCX Rabbit pAb

A0149-20ul 20 ul Ask for price

DCX Rabbit pAb

A0149-50ul 50 ul Ask for price

DCX Rabbit pAb

A1134-100ul 100 ul
EUR 308

DCX Rabbit pAb

A1134-200ul 200 ul
EUR 459

DCX Rabbit pAb

A1134-20ul 20 ul
EUR 183

Rat DCX(Doublecortin) ELISA Kit