Rat DCX(Doublecortin) ELISA Kit

Rat DCX(Doublecortin) ELISA Kit

Rat Doublecortin (DCX) ELISA Kit
RD-DCX-Ra-48Tests	Reddot Biotech	48 Tests	EUR 557

Rat Doublecortin (DCX) ELISA Kit
RD-DCX-Ra-96Tests	Reddot Biotech	96 Tests	EUR 775

Human Doublecortin (DCX) ELISA Kit
DLR-DCX-Hu-48T	DL Develop	48T	EUR 517
Should the Human Doublecortin (DCX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Doublecortin (DCX) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Doublecortin (DCX) ELISA Kit
DLR-DCX-Hu-96T	DL Develop	96T	EUR 673
Should the Human Doublecortin (DCX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Doublecortin (DCX) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Doublecortin (DCX) ELISA Kit
DLR-DCX-Mu-48T	DL Develop	48T	EUR 527
Should the Mouse Doublecortin (DCX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Doublecortin (DCX) in samples from tissue homogenates, cell lysates or other biological fluids.

Mouse Doublecortin (DCX) ELISA Kit
DLR-DCX-Mu-96T	DL Develop	96T	EUR 688
Should the Mouse Doublecortin (DCX) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Doublecortin (DCX) in samples from tissue homogenates, cell lysates or other biological fluids.

Human Doublecortin (DCX) ELISA Kit
RDR-DCX-Hu-48Tests	Reddot Biotech	48 Tests	EUR 544

Human Doublecortin (DCX) ELISA Kit
RDR-DCX-Hu-96Tests	Reddot Biotech	96 Tests	EUR 756

Mouse Doublecortin (DCX) ELISA Kit
RDR-DCX-Mu-48Tests	Reddot Biotech	48 Tests	EUR 557

Mouse Doublecortin (DCX) ELISA Kit
RDR-DCX-Mu-96Tests	Reddot Biotech	96 Tests	EUR 774

Human Doublecortin (DCX) ELISA Kit
RD-DCX-Hu-48Tests	Reddot Biotech	48 Tests	EUR 521

Human Doublecortin (DCX) ELISA Kit
RD-DCX-Hu-96Tests	Reddot Biotech	96 Tests	EUR 723

Mouse Doublecortin (DCX) ELISA Kit
RD-DCX-Mu-48Tests	Reddot Biotech	48 Tests	EUR 533

Mouse Doublecortin (DCX) ELISA Kit
RD-DCX-Mu-96Tests	Reddot Biotech	96 Tests	EUR 740

Rat Doublecortin (DCX) ELISA Kit
20-abx155452	Abbexa	EUR 7237.00 EUR 3855.00 EUR 895.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Rat Doublecortin (DCX) ELISA Kit
SEC442Ra-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 5124.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Doublecortin (DCX) in Tissue homogenates and other biological fluids.

Rat Doublecortin (DCX) ELISA Kit
SEC442Ra-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 509.64
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Doublecortin (DCX) in Tissue homogenates and other biological fluids.

Rat Doublecortin (DCX) ELISA Kit
SEC442Ra-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 685.2
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Doublecortin (DCX) in Tissue homogenates and other biological fluids.

Rat Doublecortin (DCX) ELISA Kit
SEC442Ra-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2783.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Doublecortin (DCX) in Tissue homogenates and other biological fluids.

Rat Doublecortin (DCX) ELISA Kit
4-SEC442Ra	Cloud-Clone	EUR 5175.00 EUR 2734.00 EUR 686.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Doublecortin elisa. Alternative names of the recognized antigen: DBCN DC LISX SCLH XLIS Doublin Doublecortex Lissencephalin-X Lissencephaly, X-Linked Neuronal migration protein doublecortin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Doublecortin (DCX) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

DCX/Doublecortin
CH23033	Neuromics	100 ul	EUR 179

Doublecortin/DCX
MO22113	Neuromics	100 ul	EUR 435

ELISA kit for Rat DCX (Doublecortin)
ELK6474	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Doublecortin (DCX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Doublecortin (D Show more
Description: A sandwich ELISA kit for detection of Doublecortin from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Doublecortin (DCX) CLIA Kit
20-abx493699	Abbexa	EUR 8569.00 EUR 4560.00 EUR 1052.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Rat Doublecortin (DCX) Protein
20-abx653211	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Pig Doublecortin (DCX) ELISA Kit
abx360556-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Rabbit Doublecortin (DCX) ELISA Kit
abx363566-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human DCX(Doublecortin) ELISA Kit
EH2939	FN Test	96T	EUR 524.1
Detection range: 0.156-10 ng/ml Uniprot ID: O43602 Alias: DCX/Doublecortin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 0.094 ng/ml

Mouse Doublecortin (DCX) ELISA Kit
20-abx153925	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Human Doublecortin (DCX) ELISA Kit
20-abx151342	Abbexa	EUR 7378.00 EUR 3933.00 EUR 911.00	10 × 96 tests 5 × 96 tests 96 tests
Shipped within 5-7 working days.

Sheep Doublecortin (DCX) ELISA Kit
abx364603-96tests	Abbexa	96 tests	EUR 926
Shipped within 5-12 working days.

Monkey Doublecortin (DCX) ELISA Kit
abx359063-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Chicken Doublecortin (DCX) ELISA Kit
abx355566-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Doublecortin (DCX) ELISA Kit
abx252326-96tests	Abbexa	96 tests	EUR 707
Shipped within 5-12 working days.

Human Doublecortin (DCX) ELISA Kit
SEC442Hu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4731.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Doublecortin (DCX) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Doublecortin (DCX) ELISA Kit
SEC442Hu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 477.3
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Doublecortin (DCX) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Doublecortin (DCX) ELISA Kit
SEC442Hu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 639
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Doublecortin (DCX) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Doublecortin (DCX) ELISA Kit
SEC442Hu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2575.5
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Human Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Human Doublecortin (DCX) in serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids.

Human Doublecortin (DCX) ELISA Kit
4-SEC442Hu	Cloud-Clone	EUR 4782.00 EUR 2526.00 EUR 640.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Doublecortin elisa. Alternative names of the recognized antigen: DBCN DC LISX SCLH XLIS Doublin Doublecortex Lissencephalin-X Lissencephaly, X-Linked Neuronal migration protein doublecortin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Human Doublecortin (DCX) in samples from serum, plasma, tissue homogenates, cell lysates, cell culture supernates and other biological fluids with no significant corss-reactivity with analogues from other species.

Mouse Doublecortin (DCX) ELISA Kit
SEC442Mu-10x96wellstestplate	Cloud-Clone	10x96-wells test plate	EUR 4862.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Doublecortin (DCX) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Doublecortin (DCX) ELISA Kit
SEC442Mu-1x48wellstestplate	Cloud-Clone	1x48-wells test plate	EUR 488.08
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Doublecortin (DCX) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Doublecortin (DCX) ELISA Kit
SEC442Mu-1x96wellstestplate	Cloud-Clone	1x96-wells test plate	EUR 654.4
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Doublecortin (DCX) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Doublecortin (DCX) ELISA Kit
SEC442Mu-5x96wellstestplate	Cloud-Clone	5x96-wells test plate	EUR 2644.8
The Intra-assay Precision is determined when 3 samples with low, middle and high level of Mouse Doublecortin (DCX) were tested on 3 different plates, 8 replicates in each plate CV(%) = SD/meanX100 Intra-Assay: CV<10% Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Mouse Doublecortin (DCX) in Tissue homogenates, cell lysates and other biological fluids.

Mouse Doublecortin (DCX) ELISA Kit
4-SEC442Mu	Cloud-Clone	EUR 4913.00 EUR 2595.00 EUR 655.00	10 plates of 96 wells 5 plates of 96 wells 1 plate of 96 wells
Known also as Doublecortin elisa. Alternative names of the recognized antigen: DBCN DC LISX SCLH XLIS Doublin Doublecortex Lissencephalin-X Lissencephaly, X-Linked Neuronal migration protein doublecortin
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Mouse Doublecortin (DCX) in samples from Tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Human Doublecortin ELISA Kit (DCX)
RK01252	Abclonal	96 Tests	EUR 521

Doublecortin (DCX) Antibody
20-abx119035	Abbexa	EUR 314.00 EUR 98.00 EUR 398.00 EUR 495.00	100 ug 10 ug 200 ug 300 µg
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody
20-abx112164	Abbexa	EUR 732.00 EUR 398.00	150 ul 50 ul
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody
20-abx129883	Abbexa	EUR 439.00 EUR 133.00 EUR 1233.00 EUR 592.00 EUR 328.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Doublecortin (DCX) Antibody
20-abx000574	Abbexa	EUR 411.00 EUR 592.00	100 ul 200 ul
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody
20-abx001048	Abbexa	EUR 411.00 EUR 592.00 EUR 182.00 EUR 314.00	100 ul 200 ul 20 ul 50 ul
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody
abx010988-100ug	Abbexa	100 ug	EUR 411
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody
abx031696-400ul	Abbexa	400 ul	EUR 523
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody
abx031696-80l	Abbexa	80 µl	EUR 286
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody
20-abx172159	Abbexa	EUR 857.00 EUR 439.00	1 mg 200 ug
Please enquire.

Doublecortin (DCX) Antibody
20-abx172160	Abbexa	EUR 913.00 EUR 467.00	1 mg 200 ug
Please enquire.

Doublecortin (DCX) Antibody
20-abx176199	Abbexa	EUR 1205.00 EUR 578.00	1 mg 200 ug
Please enquire.

Doublecortin (DCX) Antibody
20-abx176200	Abbexa	EUR 1233.00 EUR 592.00	1 mg 200 ug
Please enquire.

Doublecortin (DCX) Antibody
20-abx176201	Abbexa	EUR 1302.00 EUR 620.00	1 mg 200 ug
Please enquire.

Doublecortin (DCX) Antibody
20-abx327058	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody
20-abx328221	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody
abx332188-100ul	Abbexa	100 ul	EUR 425
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody
20-abx318342	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody
abx431201-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Doublecortin (DCX) Antibody
abx430931-200ul	Abbexa	200 ul	EUR 384
Shipped within 1-3 working days.

Doublecortin (DCX) Antibody
20-abx301172	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody
abx232280-100ug	Abbexa	100 ug	EUR 481
Shipped within 5-12 working days.

Recombinant Doublecortin (DCX)
4-RPC442Mu01	Cloud-Clone	EUR 492.45 EUR 235.00 EUR 1571.68 EUR 590.56 EUR 1081.12 EUR 392.00 EUR 3779.20	100 ug 10ug 1 mg 200 ug 500 ug 50ug 5 mg
Uniprot ID: O88809 Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300. Form: Freeze-dried powder Predicted Molecular Mass (KD): 44.3kDa Isoelectric Point: Inquire
Description: Recombinant Mouse Doublecortin expressed in: E.coli

ELISA kit for Human DCX (Doublecortin)
E-EL-H2033	Elabscience Biotech	1 plate of 96 wells	EUR 534
Gentaur's DCX ELISA kit utilizes the Sandwich-ELISA principle. The micro ELISA plate provided in this kit has been pre-coated with an antibody specific to Human DCX. Standards or samples are added to the micro ELISA plate wells and combined with the Show more
Description: A sandwich ELISA kit for quantitative measurement of Human DCX (Doublecortin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Human DCX (Doublecortin)
ELK2898	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Doublecortin (DCX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Doublecortin (D Show more
Description: A sandwich ELISA kit for detection of Doublecortin from Human in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Mouse DCX (Doublecortin)
ELK6420	ELK Biotech	1 plate of 96 wells	EUR 432
The microtiter plate provided in this kit has been pre-coated with an antibody specific to Doublecortin (DCX). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Doublecortin (D Show more
Description: A sandwich ELISA kit for detection of Doublecortin from Mouse in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Guinea pig Doublecortin (DCX) ELISA Kit
abx357983-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Doublecortin (DCX) CLIA Kit
abx196616-96tests	Abbexa	96 tests	EUR 825
Shipped within 5-12 working days.

Human Doublecortin (DCX) CLIA Kit
20-abx493697	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Mouse Doublecortin (DCX) CLIA Kit
20-abx493698	Abbexa	EUR 7973.00 EUR 4246.00 EUR 981.00	10 × 96 tests 5 × 96 tests 96 tests
Please enquire.

Human Doublecortin (DCX) Protein
20-abx653209	Abbexa	EUR 578.00 EUR 258.00 EUR 1720.00 EUR 690.00 EUR 425.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-15 working days.

Mouse Doublecortin (DCX) Protein
20-abx167310	Abbexa	EUR 690.00 EUR 286.00 EUR 2124.00 EUR 815.00 EUR 495.00	100 ug 10 ug 1 mg 200 ug 50 ug
Shipped within 5-7 working days.

Doublecortin (DCX) Antibody (HRP)
20-abx303593	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody (FITC)
20-abx303594	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody (Biotin)
20-abx303595	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody (HRP)
20-abx303596	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody (FITC)
20-abx303597	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Doublecortin (DCX) Antibody (Biotin)
20-abx303598	Abbexa	EUR 411.00 EUR 1845.00 EUR 599.00 EUR 182.00 EUR 300.00	100 ug 1 mg 200 ug 20 ug 50 ug
Shipped within 5-10 working days.

Anti-Doublecortin/DCX Antibody
A01053-1	BosterBio	100ug/vial	EUR 294

CLIA kit for Human DCX (Doublecortin)
E-CL-H1230	Elabscience Biotech	1 plate of 96 wells	EUR 584
Gentaur's DCX CLIA kit utilizes the Sandwich- CLIA principle. The micro CLIA plate provided in this kit has been pre-coated with an antibody specific to Human DCX . Standards or samples are added to the micro CLIA plate wells and combined with the sp Show more
Description: A sandwich CLIA kit for quantitative measurement of Human DCX (Doublecortin) in samples from Serum, Plasma, Cell supernatant

ELISA kit for Rat Neuronal migration protein doublecortin (DCX)
KTE100787-48T	Abbkine	48T	EUR 332
DCX encodes a member of the doublecortin family. The protein encoded by DCX is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach Show more
Description: Quantitative sandwich ELISA for measuring Rat Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Neuronal migration protein doublecortin (DCX)
KTE100787-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DCX encodes a member of the doublecortin family. The protein encoded by DCX is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach Show more
Description: Quantitative sandwich ELISA for measuring Rat Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Neuronal migration protein doublecortin (DCX)
KTE100787-96T	Abbkine	96T	EUR 539
DCX encodes a member of the doublecortin family. The protein encoded by DCX is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach Show more
Description: Quantitative sandwich ELISA for measuring Rat Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Doublecortin (DCX) Polyclonal Antibody (Mouse)
4-PAC442Mu01	Cloud-Clone	EUR 251.00 EUR 2576.00 EUR 640.00 EUR 316.00 EUR 215.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DCX (Met1~Met366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX)

Anti-Doublecortin/DCX Monoclonal Antibody
M01053-1	BosterBio	100ul	EUR 397
Description: Anti-Doublecortin/DCX Monoclonal Antibody tested in WB, IF, ICC, IHC, reactive to Human, Rat, Mouse

Mouse Neuronal migration protein doublecortin, Dcx ELISA KIT
ELI-26363m	Lifescience Market	96 Tests	EUR 865

Human Neuronal migration protein doublecortin, DCX ELISA KIT
ELI-26527h	Lifescience Market	96 Tests	EUR 824

Dcx/ Rat Dcx ELISA Kit
ELI-48383r	Lifescience Market	96 Tests	EUR 886

Doublecortin Phospho-Ser376 (DCX pS376) Antibody
20-abx326624	Abbexa	EUR 314.00 EUR 244.00	100 ug 50 ug
Shipped within 5-10 working days.

Human Neuronal migration protein doublecortin (DCX)
1-CSB-EP006576HU	Cusabio	EUR 505.00 EUR 265.00 EUR 1827.00 EUR 766.00 EUR 1218.00 EUR 335.00	100ug 10ug 1MG 200ug 500ug 50ug
MW: 65.3 kDa Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Neuronal migration protein doublecortin(DCX) expressed in E.coli

Doublecortin (DCX) Polyclonal Antibody (Mouse), APC
4-PAC442Mu01-APC	Cloud-Clone	EUR 351.00 EUR 3365.00 EUR 935.00 EUR 449.00 EUR 222.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DCX (Met1~Met366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with APC.

Doublecortin (DCX) Polyclonal Antibody (Mouse), Biotinylated
4-PAC442Mu01-Biotin	Cloud-Clone	EUR 316.00 EUR 2526.00 EUR 744.00 EUR 387.00 EUR 221.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DCX (Met1~Met366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with Biotin.

Doublecortin (DCX) Polyclonal Antibody (Mouse), Cy3
4-PAC442Mu01-Cy3	Cloud-Clone	EUR 427.00 EUR 4445.00 EUR 1205.00 EUR 557.00 EUR 254.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DCX (Met1~Met366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with Cy3.

Doublecortin (DCX) Polyclonal Antibody (Mouse), FITC
4-PAC442Mu01-FITC	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DCX (Met1~Met366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with FITC.

Doublecortin (DCX) Polyclonal Antibody (Mouse), HRP
4-PAC442Mu01-HRP	Cloud-Clone	EUR 321.00 EUR 2933.00 EUR 827.00 EUR 405.00 EUR 209.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DCX (Met1~Met366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with HRP.

Doublecortin (DCX) Polyclonal Antibody (Mouse), PE
4-PAC442Mu01-PE	Cloud-Clone	EUR 301.00 EUR 2712.00 EUR 768.00 EUR 379.00 EUR 197.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DCX (Met1~Met366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with PE.

Anti-DCX/Doublecortin Rabbit Monoclonal Antibody
M01053	BosterBio	100ug/vial	EUR 397
Description: Rabbit Monoclonal DCX/Doublecortin Antibody. Validated in WB and tested in Human, Mouse, Rat.

Anti-Doublecortin / DCX (aa232-242) antibody
STJ72521	St John's Laboratory	100 µg	EUR 359

Anti-Doublecortin / DCX (aa69-81) antibody
STJ73603	St John's Laboratory	100 µg	EUR 359

ELISA kit for Mouse Neuronal migration protein doublecortin (DCX)
KTE71322-48T	Abbkine	48T	EUR 332
Doublecortin encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long dist Show more
Description: Quantitative sandwich ELISA for measuring Mouse Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Neuronal migration protein doublecortin (DCX)
KTE71322-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
Doublecortin encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long dist Show more
Description: Quantitative sandwich ELISA for measuring Mouse Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Mouse Neuronal migration protein doublecortin (DCX)
KTE71322-96T	Abbkine	96T	EUR 539
Doublecortin encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long dist Show more
Description: Quantitative sandwich ELISA for measuring Mouse Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Neuronal migration protein doublecortin (DCX)
KTE62125-48T	Abbkine	48T	EUR 332
DCX encodes a member of the doublecortin family. The protein encoded by DCX is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach Show more
Description: Quantitative sandwich ELISA for measuring Human Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Neuronal migration protein doublecortin (DCX)
KTE62125-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
DCX encodes a member of the doublecortin family. The protein encoded by DCX is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach Show more
Description: Quantitative sandwich ELISA for measuring Human Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human Neuronal migration protein doublecortin (DCX)
KTE62125-96T	Abbkine	96T	EUR 539
DCX encodes a member of the doublecortin family. The protein encoded by DCX is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach Show more
Description: Quantitative sandwich ELISA for measuring Human Neuronal migration protein doublecortin (DCX) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Monoclonal Doublecortin (DCX) Antibody, Clone: 3 e1
AMM05839G	Leading Biology	0.1ml	EUR 528
Description: A Monoclonal antibody against Human Doublecortin (DCX). The antibodies are raised in Mouse and are from clone 3 e1. This antibody is applicable in IF, WB

Doublecortin (DCX) Polyclonal Antibody (Mouse), APC-Cy7
4-PAC442Mu01-APC-Cy7	Cloud-Clone	EUR 583.00 EUR 6610.00 EUR 1750.00 EUR 778.00 EUR 324.00	100ul 10ml 1ml 200ul 20ul
Sequence of the immunogen: DCX (Met1~Met366) Buffer composition: 0.01M PBS, pH7.4, containing 0.05% Proclin-300, 50% glycerol.
Description: A Rabbit polyclonal antibody against Mouse Doublecortin (DCX). This antibody is labeled with APC-Cy7.

Human Doublecortin (DCX) Differentiation Reporter (pGreenZeo, Plasmid)
SR10041PA-1	SBI	10 ug	EUR 1749
Category: Stem Cell Products

Human Doublecortin (DCX) Differentiation Reporter (pGreenZeo, Virus)
SR10041VA-1	SBI	>2 x 10^6 IFUs	EUR 755
Category: Stem Cell Products

Rat DCX ELISA Kit
ERD0155	Abclonal	96Tests	EUR 521

Rat Doublecortin ELISA kit
E02D0148-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Doublecortin ELISA kit
E02D0148-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Doublecortin ELISA kit
E02D0148-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rat Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monoclonal DCX / Doublecortin Antibody (clone 2G5), Clone: 2G5
APR11711G	Leading Biology	0.05mg	EUR 484
Description: A Monoclonal antibody against Human DCX / Doublecortin (clone 2G5). The antibodies are raised in Mouse and are from clone 2G5. This antibody is applicable in WB and IHC-P, IF, ICC, E, Flo

Polyclonal Doublecortin / DCX (aa232-242) Antibody (internal region)
AMM05841G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human Doublecortin / DCX (aa232-242) (internal region). This antibody is tested and proven to work in the following applications:

DCX ELISA Kit (Rat) (OKDD00742)
OKDD00742	Aviva Systems Biology	96 Wells	EUR 1040
Description: Description of target: This gene encodes a member of the doublecortin family. the protein encoded by this gene contains two doublecortin domains, which bind microtubules and regulate microtubule polymerization. in the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. the encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. studies in knockout mice lacking this gene suggest that this gene has a cortical role in nuclear translocation and positioning of the mitotic spindle in radial glial mitotic division. this gene is essential for neuronal migration, differentiation, and plasticity, is required for hippocampal development and also plays a role in dendrites development.;Species reactivity: Rat;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.054 ng/mL

Control/Blocking peptide for Mouse Neuronal migration protein doublecortin (DCX)
DCX11-C	Alpha Diagnostics	100 ug	EUR 164

Human DCX ELISA Kit
EHD0155	Abclonal	96Tests	EUR 521

Goat DCX ELISA Kit
EGTD0155	Abclonal	96Tests	EUR 521

Canine DCX ELISA Kit
ECD0155	Abclonal	96Tests	EUR 521

Chicken DCX ELISA Kit
ECKD0155	Abclonal	96Tests	EUR 521

Bovine DCX ELISA Kit
EBD0155	Abclonal	96Tests	EUR 521

Anserini DCX ELISA Kit
EAD0155	Abclonal	96Tests	EUR 521

DCX ELISA KIT|Human
EF006756	Lifescience Market	96 Tests	EUR 689

Porcine DCX ELISA Kit
EPD0155	Abclonal	96Tests	EUR 521

Rabbit DCX ELISA Kit
ERTD0155	Abclonal	96Tests	EUR 521

Sheep DCX ELISA Kit
ESD0155	Abclonal	96Tests	EUR 521

Mouse DCX ELISA Kit
EMD0155	Abclonal	96Tests	EUR 521

Monkey DCX ELISA Kit
EMKD0155	Abclonal	96Tests	EUR 521

Doublecortin Cell ELISA Kit
abx595182-96tests	Abbexa	96 tests	EUR 637
Shipped within 1-2 weeks.

Goat Doublecortin ELISA kit
E06D0148-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Doublecortin ELISA kit
E06D0148-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Doublecortin ELISA kit
E06D0148-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Goat Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Doublecortin ELISA kit
E01D0148-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Doublecortin ELISA kit
E01D0148-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Doublecortin ELISA kit
E01D0148-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Human Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Doublecortin ELISA kit
E03D0148-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Doublecortin ELISA kit
E03D0148-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Doublecortin ELISA kit
E03D0148-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Doublecortin ELISA kit
E04D0148-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Doublecortin ELISA kit
E04D0148-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Doublecortin ELISA kit
E04D0148-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Doublecortin ELISA kit
E08D0148-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Doublecortin ELISA kit
E08D0148-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Doublecortin ELISA kit
E08D0148-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Canine Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Doublecortin ELISA kit
E09D0148-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Doublecortin ELISA kit
E09D0148-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Doublecortin ELISA kit
E09D0148-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Doublecortin ELISA kit
E07D0148-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Doublecortin ELISA kit
E07D0148-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Doublecortin ELISA kit
E07D0148-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed
ELISA-1	Alpha Diagnostics	1	EUR 202

Guinea Pig DCX ELISA Kit
EGD0155	Abclonal	96Tests	EUR 521

DCX ELISA Kit (Human) (OKCD01675)
OKCD01675	Aviva Systems Biology	96 Wells	EUR 831
Description: Description of target: Microtubule-associated protein required for initial steps of neuronal dispersion and cortex lamination during cerebral cortex development. May act by competing with the putative neuronal protein kinase DCLK1 in binding to a target protein. May in that way participate in a signaling pathway that is crucial for neuronal interaction before and during migration, possibly as part of a calcium ion-dependent signal transduction pathway. May be part with PAFAH1B1/LIS-1 of overlapping, but distinct, signaling pathways that promote neuronal migration.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.055 ng/mL

DCX ELISA Kit (Human) (OKAN04745)
OKAN04745	Aviva Systems Biology	96 Wells	EUR 792
Description: Description of target: This gene encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. The encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. In addition, the encoded protein interacts with LIS1, the regulatory gamma subunit of platelet activating factor acetylhydrolase, and this interaction is important to proper microtubule function in the developing cortex. Mutations in this gene cause abnormal migration of neurons during development and disrupt the layering of the cortex, leading to epilepsy, cognitive disability, subcortical band heterotopia ("double cortex" syndrome) in females and lissencephaly ("smooth brain" syndrome) in males. Multiple transcript variants encoding different isoforms have been found for this gene.;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.055 ng/mL

DCX ELISA Kit (Mouse) (OKCD08134)
OKCD08134	Aviva Systems Biology	96 Wells	EUR 1001
Description: Description of target: This gene encodes a member of the doublecortin family. The protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. In the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. The encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. In addition, the encoded protein interacts with LIS1, the regulatory gamma subunit of platelet activating factor acetylhydrolase. Studies in knockout mice lacking this gene and the LIS1 gene suggest that the molecular interaction of these two genes is important in both in neuronal migration and neurogenesis, and there is a cortical role of this gene in nuclear translocation and positioning of the mitotic spindle in radial glial mitotic division. Multiple transcript variants encoding three different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ELISA;Assay info: ;Sensitivity: < 0.061ng/mL

DCX ELISA Kit (Mouse) (OKDD00730)
OKDD00730	Aviva Systems Biology	96 Wells	EUR 988
Description: Description of target: This gene encodes a member of the doublecortin family. the protein encoded by this gene is a cytoplasmic protein and contains two doublecortin domains, which bind microtubules. in the developing cortex, cortical neurons must migrate over long distances to reach the site of their final differentiation. the encoded protein appears to direct neuronal migration by regulating the organization and stability of microtubules. in addition, the encoded protein interacts with lis1, the regulatory gamma subunit of platelet activating factor acetylhydrolase. studies in knockout mice lacking this gene and the lis1 gene suggest that the molecular interaction of these two genes is important in both in neuronal migration and neurogenesis, and there is a cortical role of this gene in nuclear translocation and positioning of the mitotic spindle in radial glial mitotic division. multiple transcript variants encoding three different isoforms have been found for this gene.;Species reactivity: Mouse;Application: ;Assay info: Quantitative Sandwich ELISA;Sensitivity: <0.051 ng/mL

Guinea pig Doublecortin ELISA kit
E05D0148-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Doublecortin ELISA kit
E05D0148-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Doublecortin ELISA kit
E05D0148-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Doublecortin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit anti-Mouse Neuronal migration protein doublecortin (anti-DCX) IgG, affinity pure
DCX11-A	Alpha Diagnostics	100 ug	EUR 457

DCX Recombinant Protein (Rat)
RP197522	ABM	100 ug	Ask for price

Doublecortin Colorimetric Cell-Based ELISA Kit
EKC1174	BosterBio	100ul	EUR 572

DCX Antibody
BF0083	Affbiotech	200ul	EUR 376
Description: DCX antibody detects endogenous levels of total DCX.

DCX siRNA
20-abx913723	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DCX siRNA
20-abx913724	Abbexa	EUR 551.00 EUR 732.00	15 nmol 30 nmol
Shipped within 5-10 working days.

DCX antibody
70R-5900	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DCX antibody

DCX antibody
70R-5901	Fitzgerald	50 ug	EUR 467
Description: Rabbit polyclonal DCX antibody

DCX Antibody
ABD6268	Lifescience Market	100 ug	EUR 438

DCX antibody
38200-100ul	SAB	100ul	EUR 252

DCX Antibody
43298-100ul	SAB	100ul	EUR 252

DCX antibody
10R-8358	Fitzgerald	100 ul	EUR 392
Description: Mouse monoclonal DCX antibody

DCX antibody
10R-3812	Fitzgerald	100 ul	EUR 726
Description: Mouse monoclonal DCX antibody

DCX antibody
70R-16767	Fitzgerald	50 ul	EUR 435
Description: Rabbit polyclonal DCX antibody

DCX Antibody
DF6268	Affbiotech	200ul	EUR 304
Description: DCX Antibody detects endogenous levels of total DCX.

DCX Antibody
1-CSB-PA007685	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DCX. Recognizes DCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, ELISA;WB:1/500-1/2000.ELISA:1/10000

DCX Antibody
1-CSB-PA007687	Cusabio	EUR 222.00 EUR 195.00	100ug 50ug
Form: Liquid Buffer: Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. The antibody was affinity-purified from rabbit antiserum by affinity-chromatography using epitope-specific immunogen.
Description: A polyclonal antibody against DCX. Recognizes DCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: WB, IHC, ELISA;WB:1/500-1/2000.IHC:1/100-1/300.ELISA:1/10000

DCX Antibody
1-CSB-PA006576DA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCX. Recognizes DCX from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC, IF; Recommended dilution: WB:1:500-1:2000, IHC:1:20-1:200, IF:1:50-1:200

DCX Antibody
1-CSB-PA006576GA01HU	Cusabio	EUR 597.00 EUR 333.00	150ul 50ul
Form: Liquid Buffer: PBS with 0.02% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against DCX. Recognizes DCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB

DCX Antibody
1-CSB-PA006576LA01HU	Cusabio	EUR 317.00 EUR 335.00	100ug 50ug
Form: Liquid Buffer: Preservative: 0.03% Proclin 300 Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against DCX. Recognizes DCX from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC, IF; Recommended dilution: IHC:1:20-1:200, IF:1:50-1:200

DCX Antibody
CSB-PA189299-	Cusabio		EUR 335
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against DCX. Recognizes DCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

DCX Antibody
CSB-PA189299-100ul	Cusabio	100ul	EUR 316
Form: liquid Buffer: Supplied at 1.0mg/mL in phosphate buffered saline (without Mg2+ and Ca2+), pH 7.4, 150mM NaCl, 0.02% sodium azide and 50% glycerol. Antibodies were produced by immunizing rabbits with synthetic peptide and KLH conjugates. Antibo Show more
Description: A polyclonal antibody against DCX. Recognizes DCX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB;WB:1:500-1:1000

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)
RAT-5	Alpha Diagnostics	1	EUR 1138

Doublecortin Antibody
AF7627	Affbiotech	200ul	EUR 376
Description: Doublecortin Antibody detects endogenous levels of Doublecortin.

Doublecortin antibody
70R-36595	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Doublecortin antibody

Doublecortin antibody
70R-34503	Fitzgerald	100 ug	EUR 327
Description: Rabbit polyclonal Doublecortin antibody

Doublecortin Antibody
ABD7608	Lifescience Market	100 ug	EUR 438

Doublecortin Antibody
49313-100ul	SAB	100ul	EUR 333

Doublecortin Antibody
49313-50ul	SAB	50ul	EUR 239

Doublecortin Antibody
21630-100ul	SAB	100ul	EUR 252

Doublecortin Antibody
21630-50ul	SAB	50ul	EUR 187

Doublecortin antibody
20R-2739	Fitzgerald	50 ug	EUR 281
Description: Rabbit polyclonal Doublecortin antibody

Doublecortin Antibody
DF7608	Affbiotech	200ul	EUR 304
Description: Doublecortin Antibody detects endogenous levels of total Doublecortin.

anti-Doublecortin
YF-PA11304	Abfrontier	50 ug	EUR 363
Description: Mouse polyclonal to Doublecortin

Dcx ORF Vector (Rat) (pORF)
ORF065842	ABM	1.0 ug DNA	EUR 506

Frit Kit
FRIT-KIT	Next Advance	1each	EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Doublecortin Colorimetric Cell-Based ELISA Kit (OKAG00672)
OKAG00672	Aviva Systems Biology	96 Wells	EUR 596
Description: Description of target: ;Species reactivity: Human, Mouse, Rat;Application: ELISA;Assay info: Assay Type: Cell-Based Subtype: None Detection Method: Colorimetric 450 nm;Sensitivity:

Column Packing Kit
PACK-KIT	Next Advance	1pack	EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

DCX Conjugated Antibody
C38200	SAB	100ul	EUR 397

DCX Conjugated Antibody
C43298	SAB	100ul	EUR 397

DCX Blocking Peptide
BF0083-BP	Affbiotech	1mg	EUR 195

DCX cloning plasmid
CSB-CL006576HU-10ug	Cusabio	10ug	EUR 233
Formulation: 10 μg plasmid + 200μl Glycerol Length: 1083 Sequence: atggaacttgattttggacactttgacgaaagagataagacatccaggaacatgcgaggctcccggatgaatgggttgcctagccccactcacagcgcccactgtagcttctaccgaaccagaaccttgcaggcactgagtaatgagaagaaagccaagaaggtacgtttctacc Show more
Description: A cloning plasmid for the DCX gene.

anti- DCX antibody
FNab02280	FN Test	100µg	EUR 505.25
Recommended dilution: WB: 1:200-1:2000 Immunogen: doublecortin Uniprot ID: O43602 Gene ID: 1641 Research Area: Neuroscience, Stem Cells, Signal Transduction, Developmental biology
Description: Antibody raised against DCX

Doublecortex (DCX) Antibody
abx433506-200ul	Abbexa	200 ul	EUR 453
Shipped within 1-3 working days.

DCX Rabbit pAb
A0149-100ul	Abclonal	100 ul	EUR 308

DCX Rabbit pAb
A0149-200ul	Abclonal	200 ul	EUR 459

DCX Rabbit pAb
A0149-20ul	Abclonal	20 ul	Ask for price

DCX Rabbit pAb
A0149-50ul	Abclonal	50 ul	Ask for price

DCX Rabbit pAb
A1134-100ul	Abclonal	100 ul	EUR 308

DCX Rabbit pAb
A1134-200ul	Abclonal	200 ul	EUR 459

DCX Rabbit pAb
A1134-20ul	Abclonal	20 ul	EUR 183

Rat DCX(Doublecortin) ELISA Kit