Rat NRN1(Neuritin 1) ELISA Kit

Rat NRN1(Neuritin 1) ELISA Kit

Rat Neuritin 1 (NRN1) ELISA Kit

RDR-NRN1-Ra-48Tests 48 Tests
EUR 583

Rat Neuritin 1 (NRN1) ELISA Kit

RDR-NRN1-Ra-96Tests 96 Tests
EUR 811

Human Neuritin 1 (NRN1) ELISA Kit

DLR-NRN1-Hu-48T 48T
EUR 517
  • Should the Human Neuritin 1 (NRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuritin 1 (NRN1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Neuritin 1 (NRN1) ELISA Kit

DLR-NRN1-Hu-96T 96T
EUR 673
  • Should the Human Neuritin 1 (NRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuritin 1 (NRN1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Neuritin 1 (NRN1) ELISA Kit

DLR-NRN1-Mu-48T 48T
EUR 527
  • Should the Mouse Neuritin 1 (NRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuritin 1 (NRN1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Mouse Neuritin 1 (NRN1) ELISA Kit

DLR-NRN1-Mu-96T 96T
EUR 688
  • Should the Mouse Neuritin 1 (NRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuritin 1 (NRN1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids.

Human Neuritin 1 (NRN1) ELISA Kit

RD-NRN1-Hu-48Tests 48 Tests
EUR 521

Human Neuritin 1 (NRN1) ELISA Kit

RD-NRN1-Hu-96Tests 96 Tests
EUR 723

Mouse Neuritin 1 (NRN1) ELISA Kit

RD-NRN1-Mu-48Tests 48 Tests
EUR 533

Mouse Neuritin 1 (NRN1) ELISA Kit

RD-NRN1-Mu-96Tests 96 Tests
EUR 740

Human Neuritin 1 (NRN1) ELISA Kit

RDR-NRN1-Hu-48Tests 48 Tests
EUR 544

Human Neuritin 1 (NRN1) ELISA Kit

RDR-NRN1-Hu-96Tests 96 Tests
EUR 756

Mouse Neuritin 1 (NRN1) ELISA Kit

RDR-NRN1-Mu-48Tests 48 Tests
EUR 557

Mouse Neuritin 1 (NRN1) ELISA Kit

RDR-NRN1-Mu-96Tests 96 Tests
EUR 774

Rat Neuritin 1 (NRN1) ELISA Kit

20-abx155876
  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Neuritin 1 ELISA Kit (NRN1)

RK03849 96 Tests
EUR 521

Rat Neuritin 1(NRN1)ELISA kit

QY-E10218 96T
EUR 361

Rat Neuritin 1 (NRN1) ELISA Kit

SEH519Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuritin 1 (NRN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuritin 1 (NRN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Neuritin 1 (NRN1) ELISA Kit

SEH519Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuritin 1 (NRN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuritin 1 (NRN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Neuritin 1 (NRN1) ELISA Kit

SEH519Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuritin 1 (NRN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuritin 1 (NRN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Neuritin 1 (NRN1) ELISA Kit

SEH519Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuritin 1 (NRN1) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay: CV<12%
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuritin 1 (NRN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids.

Rat Neuritin 1 (NRN1) ELISA Kit

4-SEH519Ra
  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Neuritin 1 elisa. Alternative names of the recognized antigen: n/a
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Neuritin 1 (NRN1) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species.

Rat Nrn1/ Neuritin ELISA Kit

E0698Ra 1 Kit
EUR 571

Rat Nrn1(Neuritin) ELISA Kit

ER0313 96T
EUR 524.1
  • Detection range: 0.156-10pmol/ml
  • Uniprot ID: O08957
  • Alias: Nrn1/Neuritin
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094pmol/ml

Rat Neuritin (NRN1) ELISA Kit

abx256291-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Rat Neuritin(NRN1) ELISA kit

CSB-EL016088RA-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Neuritin (NRN1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Rat Neuritin(NRN1) ELISA kit

1-CSB-EL016088RA
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Rat Neuritin(NRN1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

ELISA kit for Rat NRN1 (Neuritin 1)

ELK6490 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuritin 1 (NRN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuritin 1 (NRN1
  • Show more
Description: A sandwich ELISA kit for detection of Neuritin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

Rat Neuritin 1 (NRN1) CLIA Kit

20-abx495460
  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

Rat Neuritin 1 (NRN1) Protein

20-abx654505
  • EUR 578.00
  • EUR 258.00
  • EUR 1720.00
  • EUR 690.00
  • EUR 425.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

Human Neuritin 1(NRN1)ELISA Kit

QY-E01644 96T
EUR 361

Mouse Neuritin 1(NRN1)ELISA kit

QY-E21065 96T
EUR 361

Nude Neuritin 1(NRN1)ELISA kit

QY-E90091 96T
EUR 478

Neuritin 1 (NRN1) Antibody

20-abx104984
  • EUR 425.00
  • EUR 133.00
  • EUR 1205.00
  • EUR 578.00
  • EUR 328.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Neuritin 1 (NRN1) Antibody

20-abx173757
  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuritin 1 (NRN1) Antibody

20-abx177747
  • EUR 1302.00
  • EUR 620.00
  • 1 mg
  • 200 ug
  • Please enquire.

Neuritin 1 (NRN1) Antibody

20-abx241583
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Neuritin 1 (NRN1) Antibody

20-abx241584
  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

Recombinant Neuritin 1 (NRN1)

4-RPH519Hu01
  • EUR 458.40
  • EUR 226.00
  • EUR 1444.00
  • EUR 548.00
  • EUR 996.00
  • EUR 370.00
  • EUR 3460.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: Q9NPD7
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 16.2kDa
  • Isoelectric Point: 6.4
Description: Recombinant Human Neuritin 1 expressed in: E.coli

Nrn1 ELISA Kit| Rat Neuritin ELISA Kit

EF017193 96 Tests
EUR 689

Cow Neuritin (NRN1) ELISA Kit

abx513206-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Neuritin (NRN1) ELISA Kit

abx513208-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human NRN1/ Neuritin ELISA Kit

E1794Hu 1 Kit
EUR 571

Human NRN1(Neuritin) ELISA Kit

EH0944 96T
EUR 567.6
  • Detection range: 31.2-2000 pg/ml
  • Uniprot ID: Q9NPD7
  • Alias: NRN1/NRN(Neuritin)/neuritin 1
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml

Human Neuritin (NRN1) ELISA Kit

abx253900-96tests 96 tests
EUR 668
  • Shipped within 5-12 working days.

Human Neuritin(NRN1) ELISA kit

CSB-EL016088HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuritin (NRN1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human Neuritin(NRN1) ELISA kit

1-CSB-EL016088HU
  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human Neuritin(NRN1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Neuritin (NRN1) Antibody

20-abx110039
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Neuritin (NRN1)

1-CSB-EP868277HU
  • EUR 380.00
  • EUR 214.00
  • EUR 1309.00
  • EUR 560.00
  • EUR 873.00
  • EUR 262.00
  • 100ug
  • 10ug
  • 1MG
  • 200ug
  • 500ug
  • 50ug
  • MW: 25.8 kDa
  • Buffer composition: Tris-based buffer with 50% glycerol.
Description: Recombinant Human Neuritin(NRN1) expressed in E.coli

Human Neuritin 1 (NRN1) Protein

20-abx166499
  • EUR 648.00
  • EUR 272.00
  • EUR 1943.00
  • EUR 759.00
  • EUR 467.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Human Neuritin 1 (NRN1) Protein

20-abx260764
  • EUR 3418.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 20 ug
  • 5 ug
  • Shipped within 5-10 working days.

Human Neuritin 1 (NRN1) Protein

20-abx262421
  • EUR 328.00
  • EUR 6397.00
  • EUR 230.00
  • 10 ug
  • 1 mg
  • 2 µg
  • Shipped within 5-10 working days.

NRN1 Human, Neuritin-1 Human Recombinant Protein, His Tag

PROTQ9NPD7-1 Regular: 10ug
EUR 317
Description: Neuritin-1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (Ala28-Gly116) containing 99 amino acids including a 10 aa His tag at N-terminus. The total calculated molecular mass is 11.02kDa.

Human Neuritin 1 (NRN1) Protein (Active)

20-abx655785
  • EUR 1024.00
  • EUR 356.00
  • EUR 3376.00
  • EUR 1233.00
  • EUR 704.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-15 working days.

NRN1 Neuritin-1 Human Recombinant Protein

PROTQ9NPD7 Regular: 20ug
EUR 317
Description: Recombinant Human NRN1 produced in E.coli cells is a non-glycosylated, homodimeric protein containing 2x88 amino acid chains and having a molecular mass of 19.4kDa. ;The NRN1 is purified by proprietary chromatographic techniques.

Neuritin 1 (NRN1) Polyclonal Antibody (Human)

4-PAH519Hu01
  • EUR 247.00
  • EUR 2510.00
  • EUR 625.00
  • EUR 310.00
  • EUR 214.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRN1 (Ala28~Phe142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1)

Polyclonal NRN1 / Neuritin Antibody (Internal)

AMM06828G 0.05mg
EUR 484
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NRN1 / Neuritin (Internal). This antibody is tested and proven to work in the following applications:

Neuritin 1 (NRN1) Polyclonal Antibody (Human), APC

4-PAH519Hu01-APC
  • EUR 345.00
  • EUR 3275.00
  • EUR 912.00
  • EUR 440.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRN1 (Ala28~Phe142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with APC.

Neuritin 1 (NRN1) Polyclonal Antibody (Human), Biotinylated

4-PAH519Hu01-Biotin
  • EUR 311.00
  • EUR 2460.00
  • EUR 727.00
  • EUR 381.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRN1 (Ala28~Phe142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with Biotin.

Neuritin 1 (NRN1) Polyclonal Antibody (Human), Cy3

4-PAH519Hu01-Cy3
  • EUR 419.00
  • EUR 4325.00
  • EUR 1175.00
  • EUR 545.00
  • EUR 251.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRN1 (Ala28~Phe142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with Cy3.

Neuritin 1 (NRN1) Polyclonal Antibody (Human), FITC

4-PAH519Hu01-FITC
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRN1 (Ala28~Phe142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with FITC.

Neuritin 1 (NRN1) Polyclonal Antibody (Human), HRP

4-PAH519Hu01-HRP
  • EUR 316.00
  • EUR 2855.00
  • EUR 807.00
  • EUR 398.00
  • EUR 206.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRN1 (Ala28~Phe142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with HRP.

Neuritin 1 (NRN1) Polyclonal Antibody (Human), PE

4-PAH519Hu01-PE
  • EUR 296.00
  • EUR 2640.00
  • EUR 750.00
  • EUR 372.00
  • EUR 195.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRN1 (Ala28~Phe142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with PE.

Recombinant Human Neuritin/NRN1 (N-6His)

CH42-10ug 10ug
EUR 146
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl,pH 8.0.

Recombinant Human Neuritin/NRN1 (N-6His)

CH42-1mg 1mg
EUR 2283
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl,pH 8.0.

Recombinant Human Neuritin/NRN1 (N-6His)

CH42-500ug 500ug
EUR 1613
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl,pH 8.0.

Recombinant Human Neuritin/NRN1 (N-6His)

CH42-50ug 50ug
EUR 303
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl,pH 8.0.

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

ELISA-1 1
EUR 202

Neuritin 1 (NRN1) Polyclonal Antibody (Human), APC-Cy7

4-PAH519Hu01-APC-Cy7
  • EUR 571.00
  • EUR 6430.00
  • EUR 1705.00
  • EUR 760.00
  • EUR 319.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: NRN1 (Ala28~Phe142)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with APC-Cy7.

Recombinant Human NRN1/ Neuritin 1 Protein, Untagged, E.coli-100ug

QP10422-ec-100ug 100ug
EUR 988

Recombinant Human NRN1/ Neuritin 1 Protein, Untagged, E.coli-20ug

QP10422-ec-20ug 20ug
EUR 290

Recombinant Human NRN1/ Neuritin 1 Protein, Untagged, E.coli-250ug

QP10422-ec-250ug 250ug
EUR 1731

Recombinant Human NRN1/ Neuritin 1 Protein, Untagged, E.coli-5ug

QP10422-ec-5ug 5ug
EUR 154

Rat Neuritin ELISA kit

E02N0599-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neuritin ELISA kit

E02N0599-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Neuritin ELISA kit

E02N0599-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rat Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Recombinant Human NRN1/ Neuritin 1 Protein, His-SUMO, E.coli-100ug

QP8091-ec-100ug 100ug
EUR 408

Recombinant Human NRN1/ Neuritin 1 Protein, His-SUMO, E.coli-10ug

QP8091-ec-10ug 10ug
EUR 200

Recombinant Human NRN1/ Neuritin 1 Protein, His-SUMO, E.coli-1mg

QP8091-ec-1mg 1mg
EUR 1632

Recombinant Human NRN1/ Neuritin 1 Protein, His-SUMO, E.coli-200ug

QP8091-ec-200ug 200ug
EUR 634

Recombinant Human NRN1/ Neuritin 1 Protein, His-SUMO, E.coli-500ug

QP8091-ec-500ug 500ug
EUR 1060

Recombinant Human NRN1/ Neuritin 1 Protein, His-SUMO, E.coli-50ug

QP8091-ec-50ug 50ug
EUR 263

Human Neuritin 1 ELISA Kit

ELA-E13381h 96 Tests
EUR 824

NRN1 ELISA Kit (Rat) (OKEH04340)

OKEH04340 96 Wells
EUR 662
Description: Description of target: promotes neurite outgrowth [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.084nmol/L

Mouse Neuritin ELISA kit

E03N0599-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Neuritin ELISA kit

E03N0599-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse Neuritin ELISA kit

E03N0599-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Mouse Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Neuritin ELISA kit

E04N0599-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Neuritin ELISA kit

E04N0599-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit Neuritin ELISA kit

E04N0599-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Rabbit Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Neuritin ELISA kit

E01N0599-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Neuritin ELISA kit

E01N0599-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human Neuritin ELISA kit

E01N0599-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Human Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Neuritin ELISA kit

E08N0599-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Neuritin ELISA kit

E08N0599-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog Neuritin ELISA kit

E08N0599-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Canine Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Neuritin ELISA kit

E09N0599-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Neuritin ELISA kit

E09N0599-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey Neuritin ELISA kit

E09N0599-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Monkey Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Neuritin ELISA kit

E07N0599-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Neuritin ELISA kit

E07N0599-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig Neuritin ELISA kit

E07N0599-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Porcine Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Neuritin ELISA kit

E06N0599-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Neuritin ELISA kit

E06N0599-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat Neuritin ELISA kit

E06N0599-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Goat Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human NRN1 ELISA Kit

ELA-E0530h 96 Tests
EUR 824

NRN1 ELISA KIT|Human

EF000648 96 Tests
EUR 689

Neuritin

GT15022 100 ug
EUR 526

Guinea pig Neuritin ELISA kit

E05N0599-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Neuritin ELISA kit

E05N0599-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig Neuritin ELISA kit

E05N0599-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A sandwich ELISA for quantitative measurement of Guinea pig Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Nrn1 ELISA Kit (Mouse) (OKEH04625)

OKEH04625 96 Wells
EUR 662
Description: Description of target: Promotes neurite outgrowth and especially branching of neuritic processes in primary hippocampal and cortical cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.179 ng/mL

Rat NRN1 shRNA Plasmid

20-abx986877
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Neuritin protein

30R-AN048 20 ug
EUR 273
Description: Purified recombinant Human/Rat Neuritin protein

Neuritin Antibody

24517-100ul 100ul
EUR 390

mRNAExpress mRNA Synthesis kit (5 reactions)

MR-KIT-1 5 reactions
EUR 1152
  • Category: Stem Cell Products

NRN1 siRNA

20-abx903660
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NRN1 siRNA

20-abx926414
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NRN1 siRNA

20-abx926415
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

NRN1 Antibody

35833-100ul 100ul
EUR 252

NRN1 Antibody

1-CSB-PA868277LA01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRN1. Recognizes NRN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200

NRN1 Antibody

DF12544 200ul
EUR 304
Description: NRN1 Antibody detects endogenous levels of NRN1.

NRN1 Antibody

1-CSB-PA793884
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NRN1. Recognizes NRN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

NRN1 Antibody

1-CSB-PA061766
  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against NRN1. Recognizes NRN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200

Nrn1 sgRNA CRISPR Lentivector (Rat) (Target 1)

K7057502 1.0 ug DNA
EUR 154

PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN320A-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1)

PIN340iPS-KIT 1 Kit
EUR 4941
  • Category: PinPoint Integrase Tools

Nrn1 ORF Vector (Rat) (pORF)

ORF071521 1.0 ug DNA
EUR 506

Mouse Neuritin- like protein, Nrn1l ELISA KIT

ELI-22406m 96 Tests
EUR 865

Human Neuritin- like protein, NRN1L ELISA KIT

ELI-36828h 96 Tests
EUR 824

Human Neuritin-like protein (NRN1L) ELISA Kit

abx385206-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Mouse Neuritin-like protein (NRN1L) ELISA Kit

abx390008-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody

EXOAB-KIT-1 25 ul each
EUR 627
  • Category: Exosomes

Nrn1l ELISA Kit| Mouse Neuritin-like protein ELISA Kit

EF015647 96 Tests
EUR 689

Polyclonal Neuritin Antibody

AMM06620G 0.1 mg
EUR 659
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Neuritin . This antibody is tested and proven to work in the following applications:

Neuritin Antibody (HRP)

20-abx108551
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuritin Antibody (Biotin)

20-abx105713
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuritin Antibody (FITC)

20-abx107130
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuritin, human recombinant

7179-10
EUR 229

Neuritin, human recombinant

7179-50
EUR 675

NRN1 ELISA Kit (Human) : 96 Wells (OKEH02852)

OKEH02852 96 Wells
EUR 662
Description: Description of target: This gene encodes a member of the neuritin family, and is expressed in postmitotic-differentiating neurons of the developmental nervous system and neuronal structures associated with plasticity in the adult. The expression of this gene can be induced by neural activity and neurotrophins. The encoded protein contains a consensus cleavage signal found in glycosylphoshatidylinositol (GPI)-anchored proteins. The encoded protein promotes neurite outgrowth and arborization, suggesting its role in promoting neuritogenesis. Overexpression of the encoded protein may be associated with astrocytoma progression. Alternative splicing results in multiple transcript variants. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN300A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents)

CAS510A-KIT 1 Kit
EUR 805
  • Category: Cas9

Rat TIMP-1 AssayMax ELISA Kit

ERT2538-1 96 Well Plate
EUR 477

PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN400A-KIT 1 Kit
EUR 2798
  • Category: PinPoint Integrase Tools

NRN1 Conjugated Antibody

C35833 100ul
EUR 397

NRN1 Polyclonal Antibody

ES9900-100ul 100ul
EUR 279
Description: A Rabbit Polyclonal antibody against NRN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NRN1 Polyclonal Antibody

ES9900-50ul 50ul
EUR 207
Description: A Rabbit Polyclonal antibody against NRN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA

NRN1 Polyclonal Antibody

ABP59537-003ml 0.03ml
EUR 158
  • Immunogen information: Synthesized peptide derived from part region of human NRN1 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of NRN1 from Human, Mouse, Rat. This NRN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRN1 protein at amino acid sequence of 40-120

NRN1 Polyclonal Antibody

ABP59537-01ml 0.1ml
EUR 289
  • Immunogen information: Synthesized peptide derived from part region of human NRN1 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of NRN1 from Human, Mouse, Rat. This NRN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRN1 protein at amino acid sequence of 40-120

NRN1 Polyclonal Antibody

ABP59537-02ml 0.2ml
EUR 414
  • Immunogen information: Synthesized peptide derived from part region of human NRN1 protein at amino acid sequence of 40-120
  • Applications tips:
Description: A polyclonal antibody for detection of NRN1 from Human, Mouse, Rat. This NRN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRN1 protein at amino acid sequence of 40-120

NRN1 Polyclonal Antibody

A55483 100 µg
EUR 570.55
Description: reagents widely cited

NRN1 cloning plasmid

CSB-CL868277HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 429
  • Sequence: atgggacttaagttgaacggcagatatatttcactgatcctcgcggtgcaaatagcgtatctggtgcaggccgtgagagcagcgggcaagtgcgatgcggtcttcaagggcttttcggactgtttgctcaagctgggcgacagcatggccaactacccgcagggcctggacgacaa
  • Show more
Description: A cloning plasmid for the NRN1 gene.

NRN1 Blocking Peptide

DF12544-BP 1mg
EUR 195

Anti-NRN1 antibody

STJ191058 200 µl
EUR 197
Description: Unconjugated Rabbit polyclonal to NRN1

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN410A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1)

PIN412A-KIT 1 Kit
EUR 4335
  • Category: PinPoint Integrase Tools

Nrn1 sgRNA CRISPR Lentivector set (Rat)

K7057501 3 x 1.0 ug
EUR 339

AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS

AP-STR-KIT-1 1/pk
EUR 355
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller

Frit Kit

FRIT-KIT 1each
EUR 124
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool.

Column Packing Kit

PACK-KIT 1pack
EUR 1035
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar.

Recombinant Human Neuritin Protein

PROTQ9NPD7-2 20ug
EUR 317
Description: Neuritin is a neurotrophic factor, which is expressed in response to induction of neuronal activity by NGF, BDNF, NT3, and other neural stimulators. It is expressed primarily in postmitotic-differentiating neurons of the developing nervous system and in neuronal structures related to synaptic plasticity in the adult nervous system. Neuritin acts as a molecular mediator of neurite outgrowth, neuronal survival, and synaptic maturation. Recombinant human Neuritin is a covalently disulfide-linked homodimer, consisting of two 9.72 kDa polypeptide monomers, each containing 88 amino acid residues.

PCR Mycoplasma Detection Kit

M034-Kit Kit
EUR 266

AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE620A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE622A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site)

GE624A-KIT 1 kit
EUR 2132
  • Category: Gene Editing

Mouse NRN1 shRNA Plasmid

20-abx976604
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human NRN1 shRNA Plasmid

20-abx959676
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

NRN1 Antibody, HRP conjugated

1-CSB-PA868277LB01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRN1. Recognizes NRN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA

NRN1 Antibody, FITC conjugated

1-CSB-PA868277LC01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRN1. Recognizes NRN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA

NRN1 Antibody, Biotin conjugated

1-CSB-PA868277LD01HU
  • EUR 317.00
  • EUR 335.00
  • 100ug
  • 50ug
  • Form: Liquid
  • Buffer: Preservative: 0.03% Proclin 300
    Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified
Description: A polyclonal antibody against NRN1. Recognizes NRN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA

NRN1 sgRNA CRISPR Lentivector (Human) (Target 1)

K1455902 1.0 ug DNA
EUR 154

Nrn1 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K4455902 1.0 ug DNA
EUR 154

Nrn1 sgRNA CRISPR Lentivector (Rat) (Target 2)

K7057503 1.0 ug DNA
EUR 154

Nrn1 sgRNA CRISPR Lentivector (Rat) (Target 3)

K7057504 1.0 ug DNA
EUR 154

NRN1 Protein Vector (Rat) (pPB-C-His)

PV286082 500 ng
EUR 603

NRN1 Protein Vector (Rat) (pPB-N-His)

PV286083 500 ng
EUR 603

NRN1 Protein Vector (Rat) (pPM-C-HA)

PV286084 500 ng
EUR 603

NRN1 Protein Vector (Rat) (pPM-C-His)

PV286085 500 ng
EUR 603

Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit

CAS400A-KIT 1 kit (10 rxn)
EUR 1110
  • Category: Cas9

CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV100PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV105PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV120PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit

CASLV125PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS700A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS720A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector

CAS740A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Neuritin-Like Protein (NRN1L) Antibody

abx027102-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Neuritin-Like Protein (NRN1L) Antibody

abx027102-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Neuritin-Like Protein (NRN1L) Antibody

20-abx301402
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV200PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV205PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV220PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit

CASLV225PA-KIT 1 Kit
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS750A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS770A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector

CAS790A-KIT 10 rxn
EUR 1132
  • Category: Cas9

Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)]

CAS9LIG-KIT 1 Kit
EUR 153
  • Category: Cas9

Nrn1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1)

K7057506 1.0 ug DNA
EUR 167

NRN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV)

LV641107 1.0 ug DNA
EUR 514

NRN1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC)

LV641111 1.0 ug DNA
EUR 514

NRN1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a)

LV641112 1.0 ug DNA
EUR 514

NRN1 Polyclonal Antibody, HRP Conjugated

A55484 100 µg
EUR 570.55
Description: Ask the seller for details

NRN1 Polyclonal Antibody, FITC Conjugated

A55485 100 µg
EUR 570.55
Description: The best epigenetics products

NRN1 Polyclonal Antibody, Biotin Conjugated

A55486 100 µg
EUR 570.55
Description: kits suitable for this type of research

NRN1 ORF Vector (Human) (pORF)

ORF007223 1.0 ug DNA
EUR 95

Nrn1 ORF Vector (Mouse) (pORF)

ORF051685 1.0 ug DNA
EUR 506

Rat Albumin AssayMax ELISA Kit

ERA2201-1 96 Well Plate
EUR 396

Rat Albumin AssayMax ELISA Kit

ERA3201-1 96 Well Plate
EUR 396

Rat Ceruloplasmin AssayMax ELISA Kit

ERC4101-1 96 Well Plate
EUR 396

Rat Haptoglobin AssayMax ELISA Kit

ERH1003-1 96 Well Plate
EUR 396

Rat Hemopexin AssayMax ELISA Kit

ERH2001-1 96 Well Plate
EUR 417

Rat Haptoglobin AssayMax ELISA Kit

ERH2003-1 96 Well Plate
EUR 396

Rat Plasminogen AssayMax ELISA Kit

ERP1200-1 96 Well Plate
EUR 396

Rat Transferrin AssayMax ELISA Kit

ERT2105-1 96 Well Plate
EUR 417

Rat Transferrin AssayMax ELISA Kit

ERT3105-1 96 Well Plate
EUR 396

Human Glutaredoxin-1 AssayMax ELISA Kit

EG2153-1 96 Well Plate
EUR 417

Human Complexin-1 AssayMax ELISA Kit

EC3505-1 96 Well Plate
EUR 417

Human Hexokinase-1 AssayMax ELISA Kit

EH3101-1 96 Well Plate
EUR 477

Rat Adiponectin (ACRP30) AssayMax ELISA Kit

ERA2500-1 96 Well Plate
EUR 396

Rat Fibrinogen (FBG) AssayMax ELISA Kit

ERF1040-1 96 Well Plate
EUR 396

Rat Fibronectin (FN) AssayMax ELISA Kit

ERF1045-1 96 Well Plate
EUR 396

Rat Fibrinogen (FBG) AssayMax ELISA Kit

ERF2040-1 96 Well Plate
EUR 396

Rat TNF-alpha AssayMax ELISA Kit

ERT2010-1 96 Well Plate
EUR 477

Neuritin-Like Protein (NRN1L) Antibody (HRP)

20-abx307272
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuritin-Like Protein (NRN1L) Antibody (FITC)

20-abx307273
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Neuritin-Like Protein (NRN1L) Antibody (Biotin)

20-abx307274
  • EUR 411.00
  • EUR 1845.00
  • EUR 599.00
  • EUR 182.00
  • EUR 300.00
  • 100 ug
  • 1 mg
  • 200 ug
  • 20 ug
  • 50 ug
  • Shipped within 5-10 working days.

Human Lipocalin-1 (LCN1) AssayMax ELISA Kit

EL3502-1 96 Well Plate
EUR 477

Human TGF-beta-1 AssayMax ELISA Kit

ET3102-1 96 Well Plate
EUR 477

Human PAI-1/tPA AssayMax ELISA Kit

EP1105-1 96 Well Plate
EUR 417

Rat NRN1(Neuritin 1) ELISA Kit