Rat NRN1(Neuritin 1) ELISA Kit
Rat Neuritin 1 (NRN1) ELISA Kit |
RDR-NRN1-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 583 |
Rat Neuritin 1 (NRN1) ELISA Kit |
RDR-NRN1-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 811 |
Human Neuritin 1 (NRN1) ELISA Kit |
DLR-NRN1-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Neuritin 1 (NRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuritin 1 (NRN1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Neuritin 1 (NRN1) ELISA Kit |
DLR-NRN1-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Neuritin 1 (NRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Neuritin 1 (NRN1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse Neuritin 1 (NRN1) ELISA Kit |
DLR-NRN1-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Neuritin 1 (NRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuritin 1 (NRN1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Mouse Neuritin 1 (NRN1) ELISA Kit |
DLR-NRN1-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Neuritin 1 (NRN1) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Neuritin 1 (NRN1) in samples from serum, plasma, tissue homogenates, cell lysates or other biological fluids. |
Human Neuritin 1 (NRN1) ELISA Kit |
RD-NRN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Neuritin 1 (NRN1) ELISA Kit |
RD-NRN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Neuritin 1 (NRN1) ELISA Kit |
RD-NRN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Neuritin 1 (NRN1) ELISA Kit |
RD-NRN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Human Neuritin 1 (NRN1) ELISA Kit |
RDR-NRN1-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Neuritin 1 (NRN1) ELISA Kit |
RDR-NRN1-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Neuritin 1 (NRN1) ELISA Kit |
RDR-NRN1-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Neuritin 1 (NRN1) ELISA Kit |
RDR-NRN1-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Rat Neuritin 1 (NRN1) ELISA Kit |
20-abx155876 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Neuritin 1 ELISA Kit (NRN1) |
RK03849 |
Abclonal |
96 Tests |
EUR 521 |
Rat Neuritin 1 (NRN1) ELISA Kit |
SEH519Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuritin 1 (NRN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuritin 1 (NRN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Rat Neuritin 1 (NRN1) ELISA Kit |
SEH519Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuritin 1 (NRN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuritin 1 (NRN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Rat Neuritin 1 (NRN1) ELISA Kit |
SEH519Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuritin 1 (NRN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuritin 1 (NRN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Rat Neuritin 1 (NRN1) ELISA Kit |
SEH519Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Neuritin 1 (NRN1) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay: CV<12%
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Neuritin 1 (NRN1) in serum, plasma, tissue homogenates, cell lysates and other biological fluids. |
Rat Neuritin 1 (NRN1) ELISA Kit |
4-SEH519Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Neuritin 1 elisa. Alternative names of the recognized antigen: n/a
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Neuritin 1 (NRN1) in samples from Serum, plasma, tissue homogenates, cell lysates and other biological fluids with no significant corss-reactivity with analogues from other species. |
Rat Nrn1/ Neuritin ELISA Kit |
E0698Ra |
Sunlong |
1 Kit |
EUR 571 |
Rat Nrn1(Neuritin) ELISA Kit |
ER0313 |
FN Test |
96T |
EUR 524.1 |
- Detection range: 0.156-10pmol/ml
- Uniprot ID: O08957
- Alias: Nrn1/Neuritin
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Rattus;Sensitivity: 0.094pmol/ml |
Rat Neuritin (NRN1) ELISA Kit |
abx256291-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Rat Neuritin(NRN1) ELISA kit |
CSB-EL016088RA-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Neuritin (NRN1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Rat Neuritin(NRN1) ELISA kit |
1-CSB-EL016088RA |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Rat Neuritin(NRN1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
ELISA kit for Rat NRN1 (Neuritin 1) |
ELK6490 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Neuritin 1 (NRN1). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific to Neuritin 1 (NRN1
- Show more
|
Description: A sandwich ELISA kit for detection of Neuritin 1 from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
Rat Neuritin 1 (NRN1) CLIA Kit |
20-abx495460 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
Rat Neuritin 1 (NRN1) Protein |
20-abx654505 |
Abbexa |
-
EUR 578.00
-
EUR 258.00
-
EUR 1720.00
-
EUR 690.00
-
EUR 425.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
Neuritin 1 (NRN1) Antibody |
20-abx104984 |
Abbexa |
-
EUR 425.00
-
EUR 133.00
-
EUR 1205.00
-
EUR 578.00
-
EUR 328.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Neuritin 1 (NRN1) Antibody |
20-abx173757 |
Abbexa |
|
|
|
Neuritin 1 (NRN1) Antibody |
20-abx177747 |
Abbexa |
|
|
|
Neuritin 1 (NRN1) Antibody |
20-abx241583 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Neuritin 1 (NRN1) Antibody |
20-abx241584 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Recombinant Neuritin 1 (NRN1) |
4-RPH519Hu01 |
Cloud-Clone |
-
EUR 458.40
-
EUR 226.00
-
EUR 1444.00
-
EUR 548.00
-
EUR 996.00
-
EUR 370.00
-
EUR 3460.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: Q9NPD7
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 16.2kDa
- Isoelectric Point: 6.4
|
Description: Recombinant Human Neuritin 1 expressed in: E.coli |
Cow Neuritin (NRN1) ELISA Kit |
abx513206-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Neuritin (NRN1) ELISA Kit |
abx513208-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human NRN1/ Neuritin ELISA Kit |
E1794Hu |
Sunlong |
1 Kit |
EUR 571 |
Human NRN1(Neuritin) ELISA Kit |
EH0944 |
FN Test |
96T |
EUR 567.6 |
- Detection range: 31.2-2000 pg/ml
- Uniprot ID: Q9NPD7
- Alias: NRN1/NRN(Neuritin)/neuritin 1
|
Description: Method of detection: Double Antibody, Sandwich ELISA;Reacts with: Homo sapiens;Sensitivity: 18.75pg/ml |
Human Neuritin (NRN1) ELISA Kit |
abx253900-96tests |
Abbexa |
96 tests |
EUR 668 |
- Shipped within 5-12 working days.
|
Human Neuritin(NRN1) ELISA kit |
CSB-EL016088HU-24T |
Cusabio |
1 plate of 24 wells |
EUR 165 |
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Neuritin (NRN1) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price. |
Human Neuritin(NRN1) ELISA kit |
1-CSB-EL016088HU |
Cusabio |
-
EUR 804.00
-
EUR 5099.00
-
EUR 2704.00
|
-
1 plate of 96 wells
-
10 plates of 96 wells each
-
5 plates of 96 wells each
|
- Sample volume: 50-100ul
- Detection wavelength: 450nm
- Assay performance time: 1 to 4 hours.
|
Description: Quantitativesandwich ELISA kit for measuring Human Neuritin(NRN1) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits. |
Neuritin (NRN1) Antibody |
20-abx110039 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Neuritin (NRN1) |
1-CSB-EP868277HU |
Cusabio |
-
EUR 380.00
-
EUR 214.00
-
EUR 1309.00
-
EUR 560.00
-
EUR 873.00
-
EUR 262.00
|
-
100ug
-
10ug
-
1MG
-
200ug
-
500ug
-
50ug
|
- MW: 25.8 kDa
- Buffer composition: Tris-based buffer with 50% glycerol.
|
Description: Recombinant Human Neuritin(NRN1) expressed in E.coli |
Human Neuritin 1 (NRN1) Protein |
20-abx166499 |
Abbexa |
-
EUR 648.00
-
EUR 272.00
-
EUR 1943.00
-
EUR 759.00
-
EUR 467.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Human Neuritin 1 (NRN1) Protein |
20-abx260764 |
Abbexa |
-
EUR 3418.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
Human Neuritin 1 (NRN1) Protein |
20-abx262421 |
Abbexa |
-
EUR 328.00
-
EUR 6397.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
NRN1 Human, Neuritin-1 Human Recombinant Protein, His Tag |
PROTQ9NPD7-1 |
BosterBio |
Regular: 10ug |
EUR 317 |
Description: Neuritin-1 Human Recombinant produced in E.Coli is a single, non-glycosylated, polypeptide chain (Ala28-Gly116) containing 99 amino acids including a 10 aa His tag at N-terminus. The total calculated molecular mass is 11.02kDa. |
Human Neuritin 1 (NRN1) Protein (Active) |
20-abx655785 |
Abbexa |
-
EUR 1024.00
-
EUR 356.00
-
EUR 3376.00
-
EUR 1233.00
-
EUR 704.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-15 working days.
|
NRN1 Neuritin-1 Human Recombinant Protein |
PROTQ9NPD7 |
BosterBio |
Regular: 20ug |
EUR 317 |
Description: Recombinant Human NRN1 produced in E.coli cells is a non-glycosylated, homodimeric protein containing 2x88 amino acid chains and having a molecular mass of 19.4kDa. ;The NRN1 is purified by proprietary chromatographic techniques. |
Neuritin 1 (NRN1) Polyclonal Antibody (Human) |
4-PAH519Hu01 |
Cloud-Clone |
-
EUR 247.00
-
EUR 2510.00
-
EUR 625.00
-
EUR 310.00
-
EUR 214.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRN1 (Ala28~Phe142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1) |
Polyclonal NRN1 / Neuritin Antibody (Internal) |
AMM06828G |
Leading Biology |
0.05mg |
EUR 484 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human NRN1 / Neuritin (Internal). This antibody is tested and proven to work in the following applications: |
Neuritin 1 (NRN1) Polyclonal Antibody (Human), APC |
4-PAH519Hu01-APC |
Cloud-Clone |
-
EUR 345.00
-
EUR 3275.00
-
EUR 912.00
-
EUR 440.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRN1 (Ala28~Phe142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with APC. |
Neuritin 1 (NRN1) Polyclonal Antibody (Human), Biotinylated |
4-PAH519Hu01-Biotin |
Cloud-Clone |
-
EUR 311.00
-
EUR 2460.00
-
EUR 727.00
-
EUR 381.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRN1 (Ala28~Phe142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with Biotin. |
Neuritin 1 (NRN1) Polyclonal Antibody (Human), Cy3 |
4-PAH519Hu01-Cy3 |
Cloud-Clone |
-
EUR 419.00
-
EUR 4325.00
-
EUR 1175.00
-
EUR 545.00
-
EUR 251.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRN1 (Ala28~Phe142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with Cy3. |
Neuritin 1 (NRN1) Polyclonal Antibody (Human), FITC |
4-PAH519Hu01-FITC |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRN1 (Ala28~Phe142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with FITC. |
Neuritin 1 (NRN1) Polyclonal Antibody (Human), HRP |
4-PAH519Hu01-HRP |
Cloud-Clone |
-
EUR 316.00
-
EUR 2855.00
-
EUR 807.00
-
EUR 398.00
-
EUR 206.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRN1 (Ala28~Phe142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with HRP. |
Neuritin 1 (NRN1) Polyclonal Antibody (Human), PE |
4-PAH519Hu01-PE |
Cloud-Clone |
-
EUR 296.00
-
EUR 2640.00
-
EUR 750.00
-
EUR 372.00
-
EUR 195.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRN1 (Ala28~Phe142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with PE. |
Recombinant Human Neuritin/NRN1 (N-6His) |
CH42-10ug |
Novoprotein |
10ug |
EUR 146 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl,pH 8.0. |
Recombinant Human Neuritin/NRN1 (N-6His) |
CH42-1mg |
Novoprotein |
1mg |
EUR 2283 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl,pH 8.0. |
Recombinant Human Neuritin/NRN1 (N-6His) |
CH42-500ug |
Novoprotein |
500ug |
EUR 1613 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl,pH 8.0. |
Recombinant Human Neuritin/NRN1 (N-6His) |
CH42-50ug |
Novoprotein |
50ug |
EUR 303 |
Description: Lyophilized from a 0.2 μm filtered solution of 20mM Tris,150mM NaCl,pH 8.0. |
Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
Neuritin 1 (NRN1) Polyclonal Antibody (Human), APC-Cy7 |
4-PAH519Hu01-APC-Cy7 |
Cloud-Clone |
-
EUR 571.00
-
EUR 6430.00
-
EUR 1705.00
-
EUR 760.00
-
EUR 319.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: NRN1 (Ala28~Phe142)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
Description: A Rabbit polyclonal antibody against Human Neuritin 1 (NRN1). This antibody is labeled with APC-Cy7. |
Recombinant Human NRN1/ Neuritin 1 Protein, Untagged, E.coli-100ug |
QP10422-ec-100ug |
EnQuireBio |
100ug |
EUR 988 |
Recombinant Human NRN1/ Neuritin 1 Protein, Untagged, E.coli-20ug |
QP10422-ec-20ug |
EnQuireBio |
20ug |
EUR 290 |
Recombinant Human NRN1/ Neuritin 1 Protein, Untagged, E.coli-250ug |
QP10422-ec-250ug |
EnQuireBio |
250ug |
EUR 1731 |
Recombinant Human NRN1/ Neuritin 1 Protein, Untagged, E.coli-5ug |
QP10422-ec-5ug |
EnQuireBio |
5ug |
EUR 154 |
Rat Neuritin ELISA kit |
E02N0599-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Neuritin ELISA kit |
E02N0599-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Neuritin ELISA kit |
E02N0599-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rat Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Recombinant Human NRN1/ Neuritin 1 Protein, His-SUMO, E.coli-100ug |
QP8091-ec-100ug |
EnQuireBio |
100ug |
EUR 408 |
Recombinant Human NRN1/ Neuritin 1 Protein, His-SUMO, E.coli-10ug |
QP8091-ec-10ug |
EnQuireBio |
10ug |
EUR 200 |
Recombinant Human NRN1/ Neuritin 1 Protein, His-SUMO, E.coli-1mg |
QP8091-ec-1mg |
EnQuireBio |
1mg |
EUR 1632 |
Recombinant Human NRN1/ Neuritin 1 Protein, His-SUMO, E.coli-200ug |
QP8091-ec-200ug |
EnQuireBio |
200ug |
EUR 634 |
Recombinant Human NRN1/ Neuritin 1 Protein, His-SUMO, E.coli-500ug |
QP8091-ec-500ug |
EnQuireBio |
500ug |
EUR 1060 |
Recombinant Human NRN1/ Neuritin 1 Protein, His-SUMO, E.coli-50ug |
QP8091-ec-50ug |
EnQuireBio |
50ug |
EUR 263 |
NRN1 ELISA Kit (Rat) (OKEH04340) |
OKEH04340 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: promotes neurite outgrowth [RGD, Feb 2006];Species reactivity: Rat;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.084nmol/L |
Mouse Neuritin ELISA kit |
E03N0599-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Neuritin ELISA kit |
E03N0599-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Mouse Neuritin ELISA kit |
E03N0599-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Mouse Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Neuritin ELISA kit |
E04N0599-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Neuritin ELISA kit |
E04N0599-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rabbit Neuritin ELISA kit |
E04N0599-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Rabbit Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Neuritin ELISA kit |
E01N0599-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Neuritin ELISA kit |
E01N0599-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Human Neuritin ELISA kit |
E01N0599-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Human Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Neuritin ELISA kit |
E08N0599-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Neuritin ELISA kit |
E08N0599-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Dog Neuritin ELISA kit |
E08N0599-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Canine Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Neuritin ELISA kit |
E09N0599-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Neuritin ELISA kit |
E09N0599-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Monkey Neuritin ELISA kit |
E09N0599-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Monkey Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Neuritin ELISA kit |
E07N0599-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Neuritin ELISA kit |
E07N0599-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Pig Neuritin ELISA kit |
E07N0599-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Porcine Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Neuritin ELISA kit |
E06N0599-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Neuritin ELISA kit |
E06N0599-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Goat Neuritin ELISA kit |
E06N0599-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Goat Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Neuritin ELISA kit |
E05N0599-192T |
B-Gene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Neuritin ELISA kit |
E05N0599-48 |
B-Gene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Guinea pig Neuritin ELISA kit |
E05N0599-96 |
B-Gene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
Description: A sandwich ELISA for quantitative measurement of Guinea pig Neuritin in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Nrn1 ELISA Kit (Mouse) (OKEH04625) |
OKEH04625 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: Promotes neurite outgrowth and especially branching of neuritic processes in primary hippocampal and cortical cells.;Species reactivity: Mouse;Application: ;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.179 ng/mL |
Rat NRN1 shRNA Plasmid |
20-abx986877 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Neuritin protein |
30R-AN048 |
Fitzgerald |
20 ug |
EUR 273 |
Description: Purified recombinant Human/Rat Neuritin protein |
Neuritin Antibody |
24517-100ul |
SAB |
100ul |
EUR 390 |
mRNAExpress mRNA Synthesis kit (5 reactions) |
MR-KIT-1 |
SBI |
5 reactions |
EUR 1152 |
- Category: Stem Cell Products
|
NRN1 siRNA |
20-abx903660 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRN1 siRNA |
20-abx926414 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRN1 siRNA |
20-abx926415 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
NRN1 Antibody |
35833-100ul |
SAB |
100ul |
EUR 252 |
NRN1 Antibody |
1-CSB-PA868277LA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRN1. Recognizes NRN1 from Human. This antibody is Unconjugated. Tested in the following application: ELISA, IHC; Recommended dilution: IHC:1:20-1:200 |
NRN1 Antibody |
DF12544 |
Affbiotech |
200ul |
EUR 304 |
Description: NRN1 Antibody detects endogenous levels of NRN1. |
NRN1 Antibody |
1-CSB-PA793884 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NRN1. Recognizes NRN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
NRN1 Antibody |
1-CSB-PA061766 |
Cusabio |
|
|
- Form: Liquid
- Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
|
Description: A polyclonal antibody against NRN1. Recognizes NRN1 from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, IHC;ELISA:1:2000-1:5000, IHC:1:50-1:200 |
Nrn1 sgRNA CRISPR Lentivector (Rat) (Target 1) |
K7057502 |
ABM |
1.0 ug DNA |
EUR 154 |
PinPoint-FC 293T Platform Kit for Targeted Gene Insertion (includes PIN320A-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN320A-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
PinPoint-FC Murine iPSC Platform Kit for Targeted Gene Insertion (includes PIN340iPS-1, PIN200A-1, PIN510A-1 & PIN600A-1) |
PIN340iPS-KIT |
SBI |
1 Kit |
EUR 4941 |
- Category: PinPoint Integrase Tools
|
Nrn1 ORF Vector (Rat) (pORF) |
ORF071521 |
ABM |
1.0 ug DNA |
EUR 506 |
Mouse Neuritin- like protein, Nrn1l ELISA KIT |
ELI-22406m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Neuritin- like protein, NRN1L ELISA KIT |
ELI-36828h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Neuritin-like protein (NRN1L) ELISA Kit |
abx385206-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
Mouse Neuritin-like protein (NRN1L) ELISA Kit |
abx390008-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
ExoAb Antibody Kit (CD9, CD63, CD81, Hsp70 antibodies, rabbit anti-human) with goat anti-rabbit HRP secondary antibody |
EXOAB-KIT-1 |
SBI |
25 ul each |
EUR 627 |
|
Nrn1l ELISA Kit| Mouse Neuritin-like protein ELISA Kit |
EF015647 |
Lifescience Market |
96 Tests |
EUR 689 |
Polyclonal Neuritin Antibody |
AMM06620G |
Leading Biology |
0.1 mg |
EUR 659 |
Description: A polyclonal antibody raised in Rabbit that recognizes and binds to Human Neuritin . This antibody is tested and proven to work in the following applications: |
Neuritin Antibody (HRP) |
20-abx108551 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuritin Antibody (Biotin) |
20-abx105713 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuritin Antibody (FITC) |
20-abx107130 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuritin, human recombinant |
7179-10 |
Biovision |
|
EUR 229 |
Neuritin, human recombinant |
7179-50 |
Biovision |
|
EUR 675 |
NRN1 ELISA Kit (Human) : 96 Wells (OKEH02852) |
OKEH02852 |
Aviva Systems Biology |
96 Wells |
EUR 662 |
Description: Description of target: This gene encodes a member of the neuritin family, and is expressed in postmitotic-differentiating neurons of the developmental nervous system and neuronal structures associated with plasticity in the adult. The expression of this gene can be induced by neural activity and neurotrophins. The encoded protein contains a consensus cleavage signal found in glycosylphoshatidylinositol (GPI)-anchored proteins. The encoded protein promotes neurite outgrowth and arborization, suggesting its role in promoting neuritogenesis. Overexpression of the encoded protein may be associated with astrocytoma progression. Alternative splicing results in multiple transcript variants. ;Species reactivity: Human;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich ELISA;Sensitivity: 0.078 ng/mL |
Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
PinPoint-FC System for Platform Cell Line Generation & Retargeting (includes PIN300A-1, FC200PA-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN300A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
T7 gRNA SmartNuclease Synthesis Kit (includes CAS510A-1 & T7 IVT synthesis reagents) |
CAS510A-KIT |
SBI |
1 Kit |
EUR 805 |
|
Rat TIMP-1 AssayMax ELISA Kit |
ERT2538-1 |
AssayPro |
96 Well Plate |
EUR 477 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting (includes PIN400A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN400A-KIT |
SBI |
1 Kit |
EUR 2798 |
- Category: PinPoint Integrase Tools
|
NRN1 Conjugated Antibody |
C35833 |
SAB |
100ul |
EUR 397 |
NRN1 Polyclonal Antibody |
ES9900-100ul |
ELK Biotech |
100ul |
EUR 279 |
Description: A Rabbit Polyclonal antibody against NRN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NRN1 Polyclonal Antibody |
ES9900-50ul |
ELK Biotech |
50ul |
EUR 207 |
Description: A Rabbit Polyclonal antibody against NRN1 from Human/Mouse/Rat. This antibody is tested and validated for WB, ELISA, WB, ELISA |
NRN1 Polyclonal Antibody |
ABP59537-003ml |
Abbkine |
0.03ml |
EUR 158 |
- Immunogen information: Synthesized peptide derived from part region of human NRN1 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of NRN1 from Human, Mouse, Rat. This NRN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRN1 protein at amino acid sequence of 40-120 |
NRN1 Polyclonal Antibody |
ABP59537-01ml |
Abbkine |
0.1ml |
EUR 289 |
- Immunogen information: Synthesized peptide derived from part region of human NRN1 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of NRN1 from Human, Mouse, Rat. This NRN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRN1 protein at amino acid sequence of 40-120 |
NRN1 Polyclonal Antibody |
ABP59537-02ml |
Abbkine |
0.2ml |
EUR 414 |
- Immunogen information: Synthesized peptide derived from part region of human NRN1 protein at amino acid sequence of 40-120
- Applications tips:
|
Description: A polyclonal antibody for detection of NRN1 from Human, Mouse, Rat. This NRN1 antibody is for WB, ELISA. It is affinity-purified from rabbit serum by affinity-chromatography using the specific immunogenand is unconjugated. The antibody is produced in rabbit by using as an immunogen synthesized peptide derived from part region of human NRN1 protein at amino acid sequence of 40-120 |
NRN1 Polyclonal Antibody |
A55483 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: reagents widely cited |
NRN1 cloning plasmid |
CSB-CL868277HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 429
- Sequence: atgggacttaagttgaacggcagatatatttcactgatcctcgcggtgcaaatagcgtatctggtgcaggccgtgagagcagcgggcaagtgcgatgcggtcttcaagggcttttcggactgtttgctcaagctgggcgacagcatggccaactacccgcagggcctggacgacaa
- Show more
|
Description: A cloning plasmid for the NRN1 gene. |
NRN1 Blocking Peptide |
DF12544-BP |
Affbiotech |
1mg |
EUR 195 |
Anti-NRN1 antibody |
STJ191058 |
St John's Laboratory |
200 µl |
EUR 197 |
Description: Unconjugated Rabbit polyclonal to NRN1 |
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, GE601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN410A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
PinPoint-HR System for Platform Cell Line Generation & Retargeting of AAVS1 Safe Harbor Locus (includes PIN410A-1, CAS601A-1, PIN200A-1, PIN510A-1, & PIN600A-1) |
PIN412A-KIT |
SBI |
1 Kit |
EUR 4335 |
- Category: PinPoint Integrase Tools
|
Nrn1 sgRNA CRISPR Lentivector set (Rat) |
K7057501 |
ABM |
3 x 1.0 ug |
EUR 339 |
AXYPET STARTER KIT 1 AP-20, AP-200 & AP-1000 WITH ADDITIONAL FREE RACKS OF AXYGEN PIPETTE TIPS |
AP-STR-KIT-1 |
CORNING |
1/pk |
EUR 355 |
Description: Corning and Axygen Liquid Handling Equipment; Axypet Pipettors and Motopet Pipet Controller |
Frit Kit |
FRIT-KIT |
Next Advance |
1each |
EUR 124 |
Description: Kit to create frits in capillaries. Includes formamide, Kasil-1, Kasil-1624 and a cleaving tool. |
Column Packing Kit |
PACK-KIT |
Next Advance |
1pack |
EUR 1035 |
Description: Column packing kit for pressure cells. Includes: HPREG regulator, TBNG10 tubing, CAP-75 capillary, and STRB5X2 stir bar. |
Recombinant Human Neuritin Protein |
PROTQ9NPD7-2 |
BosterBio |
20ug |
EUR 317 |
Description: Neuritin is a neurotrophic factor, which is expressed in response to induction of neuronal activity by NGF, BDNF, NT3, and other neural stimulators. It is expressed primarily in postmitotic-differentiating neurons of the developing nervous system and in neuronal structures related to synaptic plasticity in the adult nervous system. Neuritin acts as a molecular mediator of neurite outgrowth, neuronal survival, and synaptic maturation. Recombinant human Neuritin is a covalently disulfide-linked homodimer, consisting of two 9.72 kDa polypeptide monomers, each containing 88 amino acid residues. |
PCR Mycoplasma Detection Kit |
M034-Kit |
TOKU-E |
Kit |
EUR 266 |
AAVS1 Safe Harbor Targeting Vector 2.0 - All-Purpose Donor (AAVS1-SA-puro-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE620A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - GOI Knock-in Donor (AAVS1-SA-puro-EF1-MCS), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE622A-KIT |
SBI |
1 kit |
EUR 2132 |
|
AAVS1 Safe Harbor Targeting Vector 2.0 - Reporter Knock-in Donor (AAVS1-SA-puro-MCS-GFP), Complete Kit with CAS601A-1 (Cas9 SmartNuclease AAVS1-gRNA Targeting Vector) and GE640PR-1 (Junction PCR Primer Mix to confirm AAVS1 integration site) |
GE624A-KIT |
SBI |
1 kit |
EUR 2132 |
|
Mouse NRN1 shRNA Plasmid |
20-abx976604 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human NRN1 shRNA Plasmid |
20-abx959676 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
NRN1 Antibody, HRP conjugated |
1-CSB-PA868277LB01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRN1. Recognizes NRN1 from Human. This antibody is HRP conjugated. Tested in the following application: ELISA |
NRN1 Antibody, FITC conjugated |
1-CSB-PA868277LC01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRN1. Recognizes NRN1 from Human. This antibody is FITC conjugated. Tested in the following application: ELISA |
NRN1 Antibody, Biotin conjugated |
1-CSB-PA868277LD01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: Preservative: 0.03% Proclin 300
Constituents: 50% Glycerol, 0.01M PBS, PH 7.4 >95%, Protein G purified |
Description: A polyclonal antibody against NRN1. Recognizes NRN1 from Human. This antibody is Biotin conjugated. Tested in the following application: ELISA |
NRN1 sgRNA CRISPR Lentivector (Human) (Target 1) |
K1455902 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrn1 sgRNA CRISPR Lentivector (Mouse) (Target 1) |
K4455902 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrn1 sgRNA CRISPR Lentivector (Rat) (Target 2) |
K7057503 |
ABM |
1.0 ug DNA |
EUR 154 |
Nrn1 sgRNA CRISPR Lentivector (Rat) (Target 3) |
K7057504 |
ABM |
1.0 ug DNA |
EUR 154 |
NRN1 Protein Vector (Rat) (pPB-C-His) |
PV286082 |
ABM |
500 ng |
EUR 603 |
NRN1 Protein Vector (Rat) (pPB-N-His) |
PV286083 |
ABM |
500 ng |
EUR 603 |
NRN1 Protein Vector (Rat) (pPM-C-HA) |
PV286084 |
ABM |
500 ng |
EUR 603 |
NRN1 Protein Vector (Rat) (pPM-C-His) |
PV286085 |
ABM |
500 ng |
EUR 603 |
Cas9 Protein and T7 gRNA SmartNuclease Synthesis Kit |
CAS400A-KIT |
SBI |
1 kit (10 rxn) |
EUR 1110 |
|
CMV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV100PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
CMV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV105PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-T2A-Puro SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV120PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
MSCV-hspCas9-EF1-GFP SmartNuclease Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV125PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + EF1-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS700A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CAG-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS720A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + CMV-T7-hspCas9-H1-gRNA linearized SmartNuclease vector |
CAS740A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Neuritin-Like Protein (NRN1L) Antibody |
abx027102-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Neuritin-Like Protein (NRN1L) Antibody |
abx027102-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Neuritin-Like Protein (NRN1L) Antibody |
20-abx301402 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Cas9 Nickase: CMV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV200PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: CMV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV205PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-T2A-Puro SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV220PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Cas9 Nickase: MSCV-hspCas9(D10A)-EF1-GFP SmartNickase Lentivector Plasmid + LentiStarter Packaging Kit |
CASLV225PA-KIT |
SBI |
1 Kit |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: EF1-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS750A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CAG-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS770A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Multiplex gRNA Kit + Cas9 Nickase: CMV-T7-hspCas9-nickase-H1-gRNA linearized SmartNickase vector |
CAS790A-KIT |
SBI |
10 rxn |
EUR 1132 |
|
Cas9 SmartNuclease Extra Ligation Kit [includes 5x ligation buffer (10 ul) and Fast ligase (2.5ul)] |
CAS9LIG-KIT |
SBI |
1 Kit |
EUR 153 |
|
Nrn1 sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1) |
K7057506 |
ABM |
1.0 ug DNA |
EUR 167 |
NRN1 Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
LV641107 |
ABM |
1.0 ug DNA |
EUR 514 |
NRN1 Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
LV641111 |
ABM |
1.0 ug DNA |
EUR 514 |
NRN1 Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
LV641112 |
ABM |
1.0 ug DNA |
EUR 514 |
NRN1 Polyclonal Antibody, HRP Conjugated |
A55484 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: Ask the seller for details |
NRN1 Polyclonal Antibody, FITC Conjugated |
A55485 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: The best epigenetics products |
NRN1 Polyclonal Antibody, Biotin Conjugated |
A55486 |
EpiGentek |
100 µg |
EUR 570.55 |
Description: kits suitable for this type of research |
NRN1 ORF Vector (Human) (pORF) |
ORF007223 |
ABM |
1.0 ug DNA |
EUR 95 |
Nrn1 ORF Vector (Mouse) (pORF) |
ORF051685 |
ABM |
1.0 ug DNA |
EUR 506 |
Rat Albumin AssayMax ELISA Kit |
ERA2201-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Rat Albumin AssayMax ELISA Kit |
ERA3201-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Rat Ceruloplasmin AssayMax ELISA Kit |
ERC4101-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Rat Haptoglobin AssayMax ELISA Kit |
ERH1003-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Rat Hemopexin AssayMax ELISA Kit |
ERH2001-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Rat Haptoglobin AssayMax ELISA Kit |
ERH2003-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Rat Plasminogen AssayMax ELISA Kit |
ERP1200-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Rat Transferrin AssayMax ELISA Kit |
ERT2105-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Rat Transferrin AssayMax ELISA Kit |
ERT3105-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Human Glutaredoxin-1 AssayMax ELISA Kit |
EG2153-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Complexin-1 AssayMax ELISA Kit |
EC3505-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Human Hexokinase-1 AssayMax ELISA Kit |
EH3101-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Rat Adiponectin (ACRP30) AssayMax ELISA Kit |
ERA2500-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Rat Fibrinogen (FBG) AssayMax ELISA Kit |
ERF1040-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Rat Fibronectin (FN) AssayMax ELISA Kit |
ERF1045-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Rat Fibrinogen (FBG) AssayMax ELISA Kit |
ERF2040-1 |
AssayPro |
96 Well Plate |
EUR 396 |
Rat TNF-alpha AssayMax ELISA Kit |
ERT2010-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Neuritin-Like Protein (NRN1L) Antibody (HRP) |
20-abx307272 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuritin-Like Protein (NRN1L) Antibody (FITC) |
20-abx307273 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Neuritin-Like Protein (NRN1L) Antibody (Biotin) |
20-abx307274 |
Abbexa |
-
EUR 411.00
-
EUR 1845.00
-
EUR 599.00
-
EUR 182.00
-
EUR 300.00
|
-
100 ug
-
1 mg
-
200 ug
-
20 ug
-
50 ug
|
- Shipped within 5-10 working days.
|
Human Lipocalin-1 (LCN1) AssayMax ELISA Kit |
EL3502-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human TGF-beta-1 AssayMax ELISA Kit |
ET3102-1 |
AssayPro |
96 Well Plate |
EUR 477 |
Human PAI-1/tPA AssayMax ELISA Kit |
EP1105-1 |
AssayPro |
96 Well Plate |
EUR 417 |
Rat NRN1(Neuritin 1) ELISA Kit