Rat UROD(Uroporphyrinogen Decarboxylase) ELISA Kit
 ELISA Kit) Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
RD-UROD-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
RD-UROD-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 775 |
 ELISA Kit) Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
DLR-UROD-Hu-48T |
DL Develop |
48T |
EUR 517 |
- Should the Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroporphyrinogen Decarboxylase (UROD) in samples from tissue homogenates or other biological fluids. |
Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
DLR-UROD-Hu-96T |
DL Develop |
96T |
EUR 673 |
- Should the Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroporphyrinogen Decarboxylase (UROD) in samples from tissue homogenates or other biological fluids. |
 ELISA Kit) Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
DLR-UROD-Mu-48T |
DL Develop |
48T |
EUR 527 |
- Should the Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uroporphyrinogen Decarboxylase (UROD) in samples from tissue homogenates or other biological fluids. |
Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
DLR-UROD-Mu-96T |
DL Develop |
96T |
EUR 688 |
- Should the Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uroporphyrinogen Decarboxylase (UROD) in samples from tissue homogenates or other biological fluids. |
Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
RDR-UROD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 544 |
Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
RDR-UROD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 756 |
Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
RDR-UROD-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 557 |
Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
RDR-UROD-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 774 |
Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
RD-UROD-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 521 |
Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
RD-UROD-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 723 |
Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
RD-UROD-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 533 |
Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
RD-UROD-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 740 |
Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
20-abx156211 |
Abbexa |
-
EUR 7237.00
-
EUR 3855.00
-
EUR 895.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
- Shipped within 5-7 working days.
|
Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
SEG479Ra-10x96wellstestplate |
Cloud-Clone |
10x96-wells test plate |
EUR 5124.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroporphyrinogen Decarboxylase (UROD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroporphyrinogen Decarboxylase (UROD) in Tissue homogenates and other biological fluids. |
Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
SEG479Ra-1x48wellstestplate |
Cloud-Clone |
1x48-wells test plate |
EUR 509.64 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroporphyrinogen Decarboxylase (UROD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroporphyrinogen Decarboxylase (UROD) in Tissue homogenates and other biological fluids. |
Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
SEG479Ra-1x96wellstestplate |
Cloud-Clone |
1x96-wells test plate |
EUR 685.2 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroporphyrinogen Decarboxylase (UROD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroporphyrinogen Decarboxylase (UROD) in Tissue homogenates and other biological fluids. |
Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
SEG479Ra-5x96wellstestplate |
Cloud-Clone |
5x96-wells test plate |
EUR 2783.4 |
- The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroporphyrinogen Decarboxylase (UROD) were tested on 3 different plates, 8 replicates in each plate
- CV(%) = SD/meanX100
- Intra-Assay: CV<10%
- Inter-Assay:
- Show more
|
|
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroporphyrinogen Decarboxylase (UROD) in Tissue homogenates and other biological fluids. |
Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit |
|
4-SEG479Ra |
Cloud-Clone |
-
EUR 5175.00
-
EUR 2734.00
-
EUR 686.00
|
-
10 plates of 96 wells
-
5 plates of 96 wells
-
1 plate of 96 wells
|
- Known also as Uroporphyrinogen Decarboxylase elisa. Alternative names of the recognized antigen: PCT
- Uroporphyrinogen III Decarboxylase
|
|
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Uroporphyrinogen Decarboxylase (UROD) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species. |
 Antibody) Uroporphyrinogen Decarboxylase (UROD) Antibody |
|
20-abx130404 |
Abbexa |
-
EUR 453.00
-
EUR 133.00
-
EUR 1302.00
-
EUR 620.00
-
EUR 342.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
Uroporphyrinogen Decarboxylase (UROD) Antibody |
|
20-abx175046 |
Abbexa |
|
|
|
|
) Recombinant Uroporphyrinogen Decarboxylase (UROD) |
|
4-RPG479Ra01 |
Cloud-Clone |
-
EUR 503.20
-
EUR 238.00
-
EUR 1612.00
-
EUR 604.00
-
EUR 1108.00
-
EUR 400.00
-
EUR 3880.00
|
-
100 ug
-
10ug
-
1 mg
-
200 ug
-
500 ug
-
50ug
-
5 mg
|
- Uniprot ID: P32362
- Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
- Form: Freeze-dried powder
- Predicted Molecular Mass (KD): 44.2kDa
- Isoelectric Point: Inquire
|
|
Description: Recombinant Rat Uroporphyrinogen Decarboxylase expressed in: E.coli |
 Protein) Rat Uroporphyrinogen Decarboxylase (UROD) Protein |
|
20-abx167659 |
Abbexa |
-
EUR 704.00
-
EUR 286.00
-
EUR 2165.00
-
EUR 829.00
-
EUR 495.00
|
-
100 ug
-
10 ug
-
1 mg
-
200 ug
-
50 ug
|
- Shipped within 5-7 working days.
|
 CLIA Kit) Rat Uroporphyrinogen Decarboxylase (UROD) CLIA Kit |
|
20-abx495214 |
Abbexa |
-
EUR 8569.00
-
EUR 4560.00
-
EUR 1052.00
|
-
10 × 96 tests
-
5 × 96 tests
-
96 tests
|
|
|
) ELISA kit for Rat UROD (Uroporphyrinogen Decarboxylase) |
|
ELK6632 |
ELK Biotech |
1 plate of 96 wells |
EUR 432 |
- The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroporphyrinogen Decarboxylase (UROD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
- Show more
|
|
Description: A sandwich ELISA kit for detection of Uroporphyrinogen Decarboxylase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids. |
) ELISA kit for Rat Uroporphyrinogen decarboxylase (UROD) |
|
KTE100023-48T |
Abbkine |
48T |
EUR 332 |
- URODencodes the fifth enzyme of the heme biosynthetic pathway. This enzyme is responsible for catalyzing the conversion of uroporphyrinogen to coproporphyrinogen through the removal of four carboxymethyl side chains.Uroporphyrinogen III decarboxylase
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Uroporphyrinogen decarboxylase (UROD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Uroporphyrinogen decarboxylase (UROD) |
|
KTE100023-5platesof96wells |
Abbkine |
5 plates of 96 wells |
EUR 2115 |
- URODencodes the fifth enzyme of the heme biosynthetic pathway. This enzyme is responsible for catalyzing the conversion of uroporphyrinogen to coproporphyrinogen through the removal of four carboxymethyl side chains.Uroporphyrinogen III decarboxylase
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Uroporphyrinogen decarboxylase (UROD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
ELISA kit for Rat Uroporphyrinogen decarboxylase (UROD) |
|
KTE100023-96T |
Abbkine |
96T |
EUR 539 |
- URODencodes the fifth enzyme of the heme biosynthetic pathway. This enzyme is responsible for catalyzing the conversion of uroporphyrinogen to coproporphyrinogen through the removal of four carboxymethyl side chains.Uroporphyrinogen III decarboxylase
- Show more
|
|
Description: Quantitative sandwich ELISA for measuring Rat Uroporphyrinogen decarboxylase (UROD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids. |
 Mouse Uroporphyrinogen decarboxylase, Urod ELISA KIT |
|
ELI-09119m |
Lifescience Market |
96 Tests |
EUR 865 |
 Human Uroporphyrinogen decarboxylase, UROD ELISA KIT |
|
ELI-46765h |
Lifescience Market |
96 Tests |
EUR 824 |
 Polyclonal Antibody (Rat)) Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat) |
|
4-PAG479Ra01 |
Cloud-Clone |
-
EUR 259.00
-
EUR 2708.00
-
EUR 670.00
-
EUR 328.00
-
EUR 219.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UROD (Asn1~Asn364)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD) |
 Antibody) Uroporphyrinogen III Decarboxylase (UROD) Antibody |
|
20-abx004210 |
Abbexa |
-
EUR 411.00
-
EUR 592.00
-
EUR 182.00
-
EUR 314.00
|
-
100 ul
-
200 ul
-
20 ul
-
50 ul
|
- Shipped within 5-10 working days.
|
Uroporphyrinogen III Decarboxylase (UROD) Antibody |
|
abx036101-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Uroporphyrinogen III Decarboxylase (UROD) Antibody |
|
20-abx141761 |
Abbexa |
-
EUR 370.00
-
EUR 606.00
-
EUR 300.00
|
|
- Shipped within 5-10 working days.
|
Uroporphyrinogen III Decarboxylase (UROD) Antibody |
|
abx239292-100ug |
Abbexa |
100 ug |
EUR 509 |
- Shipped within 5-12 working days.
|
Uroporphyrinogen III Decarboxylase (UROD) Antibody |
|
abx433428-200ul |
Abbexa |
200 ul |
EUR 384 |
- Shipped within 1-3 working days.
|
 ELISA Kit) Human Uroporphyrinogen III decarboxylase (UROD) ELISA Kit |
|
abx384155-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 Polyclonal Antibody (Rat), APC) Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), APC |
|
4-PAG479Ra01-APC |
Cloud-Clone |
-
EUR 364.00
-
EUR 3545.00
-
EUR 980.00
-
EUR 467.00
-
EUR 227.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UROD (Asn1~Asn364)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with APC. |
 Polyclonal Antibody (Rat), Biotinylated) Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), Biotinylated |
|
4-PAG479Ra01-Biotin |
Cloud-Clone |
-
EUR 325.00
-
EUR 2658.00
-
EUR 777.00
-
EUR 400.00
-
EUR 225.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UROD (Asn1~Asn364)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with Biotin. |
 Polyclonal Antibody (Rat), Cy3) Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), Cy3 |
|
4-PAG479Ra01-Cy3 |
Cloud-Clone |
-
EUR 444.00
-
EUR 4685.00
-
EUR 1265.00
-
EUR 581.00
-
EUR 261.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UROD (Asn1~Asn364)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with Cy3. |
 Polyclonal Antibody (Rat), FITC) Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), FITC |
|
4-PAG479Ra01-FITC |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UROD (Asn1~Asn364)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with FITC. |
 Polyclonal Antibody (Rat), HRP) Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), HRP |
|
4-PAG479Ra01-HRP |
Cloud-Clone |
-
EUR 332.00
-
EUR 3089.00
-
EUR 866.00
-
EUR 421.00
-
EUR 213.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UROD (Asn1~Asn364)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with HRP. |
 Polyclonal Antibody (Rat), PE) Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), PE |
|
4-PAG479Ra01-PE |
Cloud-Clone |
-
EUR 311.00
-
EUR 2856.00
-
EUR 804.00
-
EUR 393.00
-
EUR 202.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UROD (Asn1~Asn364)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with PE. |
 UROD Uroporphyrinogen Decarboxylase Human Recombinant Protein |
|
PROTP06132 |
BosterBio |
Regular: 25ug |
EUR 317 |
|
Description: UROD Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 387 amino acids (1-367 a.a.) and having a molecular mass of 43 kDa. The UROD is fused to 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques. |
 Polyclonal Antibody (Rat), APC-Cy7) Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), APC-Cy7 |
|
4-PAG479Ra01-APC-Cy7 |
Cloud-Clone |
-
EUR 608.00
-
EUR 6970.00
-
EUR 1840.00
-
EUR 814.00
-
EUR 335.00
|
-
100ul
-
10ml
-
1ml
-
200ul
-
20ul
|
- Sequence of the immunogen: UROD (Asn1~Asn364)
- Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
|
|
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with APC-Cy7. |
) Recombinant Human Uroporphyrinogen Decarboxylase/UROD (N-6His) |
|
C273-10ug |
Novoprotein |
10ug |
EUR 202 |
|
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 1mM EDTA, pH 8.0. |
Recombinant Human Uroporphyrinogen Decarboxylase/UROD (N-6His) |
|
C273-1mg |
Novoprotein |
1mg |
EUR 2283 |
|
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 1mM EDTA, pH 8.0. |
Recombinant Human Uroporphyrinogen Decarboxylase/UROD (N-6His) |
|
C273-500ug |
Novoprotein |
500ug |
EUR 1613 |
|
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 1mM EDTA, pH 8.0. |
Recombinant Human Uroporphyrinogen Decarboxylase/UROD (N-6His) |
|
C273-50ug |
Novoprotein |
50ug |
EUR 496 |
|
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 1mM EDTA, pH 8.0. |
 Uroporphyrinogen Decarboxylase Antibody |
|
20-abx116548 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
) Uroporphyrinogen Decarboxylase (Recombinant) |
|
20-abx073136 |
Abbexa |
-
EUR 2861.00
-
EUR 328.00
-
EUR 230.00
|
|
- Shipped within 5-10 working days.
|
 Recombinant Human Uroporphyrinogen Decarboxylase |
|
7-03796 |
CHI Scientific |
5µg |
Ask for price |
Recombinant Human Uroporphyrinogen Decarboxylase |
|
7-03797 |
CHI Scientific |
25µg |
Ask for price |
Recombinant Human Uroporphyrinogen Decarboxylase |
|
7-03798 |
CHI Scientific |
1mg |
Ask for price |
 (OKCD01000)) UROD ELISA Kit (Rat) (OKCD01000) |
|
OKCD01000 |
Aviva Systems Biology |
96 Wells |
EUR 896 |
|
Description: Description of target: Catalyzes the decarboxylation of four acetate groups of uroporphyrinogen-III to yield coproporphyrinogen-III.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL |
) UROD Recombinant Protein (Rat) |
|
RP235991 |
ABM |
100 ug |
Ask for price |
 Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed |
|
ELISA-1 |
Alpha Diagnostics |
1 |
EUR 202 |
 UROD antibody |
|
70R-1254 |
Fitzgerald |
100 ug |
EUR 377 |
|
Description: Rabbit polyclonal UROD antibody raised against the N terminal of UROD |
UROD antibody |
|
70R-21183 |
Fitzgerald |
50 ul |
EUR 435 |
|
Description: Rabbit polyclonal UROD antibody |
 UROD Antibody |
|
32886-100ul |
SAB |
100ul |
EUR 252 |
UROD Antibody |
|
DF7374 |
Affbiotech |
200ul |
EUR 304 |
|
Description: UROD Antibody detects endogenous levels of total UROD. |
UROD Antibody |
|
1-CSB-PA025678GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
|
|
Description: A polyclonal antibody against UROD. Recognizes UROD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB |
 UROD siRNA |
|
20-abx939121 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
UROD siRNA |
|
20-abx939122 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
 anti-UROD |
|
YF-PA15241 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to UROD |
anti-UROD |
|
YF-PA15242 |
Abfrontier |
50 ul |
EUR 363 |
|
Description: Mouse polyclonal to UROD |
anti-UROD |
|
YF-PA15243 |
Abfrontier |
50 ug |
EUR 363 |
|
Description: Mouse polyclonal to UROD |
anti-UROD |
|
YF-PA15244 |
Abfrontier |
100 ug |
EUR 403 |
|
Description: Rabbit polyclonal to UROD |
anti-UROD |
|
YF-PA24946 |
Abfrontier |
50 ul |
EUR 334 |
|
Description: Mouse polyclonal to UROD |
 Rat Dopamine decarboxylase ELISA kit |
|
E02D0232-192T |
BlueGene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Dopamine decarboxylase ELISA kit |
|
E02D0232-48 |
BlueGene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Dopamine decarboxylase ELISA kit |
|
E02D0232-96 |
BlueGene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 Rat Ornithine Decarboxylase ELISA kit |
|
E02O0013-192T |
BlueGene |
192 tests |
EUR 1270 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ornithine Decarboxylase ELISA kit |
|
E02O0013-48 |
BlueGene |
1 plate of 48 wells |
EUR 520 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
Rat Ornithine Decarboxylase ELISA kit |
|
E02O0013-96 |
BlueGene |
1 plate of 96 wells |
EUR 685 |
- Kit contents: 1. MICROTITER PLATE * 1
2. ENZYME CONJUGATE*1 vial
3. STANDARD A*1 vial
4. STANDARD B*1 vial
5. STANDARD C*1 vial
6. STANDARD D*1 vial
7. STANDARD E*1 vial
8. STANDARD F*1 vial
9. SUBSTRATE A*1 vial
10. SUBSTRATE B*1 vial
11. STOP SOLUT
- Show more
|
|
Description: A competitive ELISA for quantitative measurement of Rat Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species. |
 (pORF)) Urod ORF Vector (Rat) (pORF) |
|
ORF078665 |
ABM |
1.0 ug DNA |
EUR 506 |
 ELISA Kit) Human Uroporphyrinogen III Synthase (UROS) ELISA Kit |
|
DLR-UROS-Hu-48T |
DL Develop |
48T |
EUR 554 |
- Should the Human Uroporphyrinogen III Synthase (UROS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroporphyrinogen III Synthase (UROS) in samples from serum, plasma, tissue homogenates or other biological fluids. |
Human Uroporphyrinogen III Synthase (UROS) ELISA Kit |
|
DLR-UROS-Hu-96T |
DL Develop |
96T |
EUR 725 |
- Should the Human Uroporphyrinogen III Synthase (UROS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
|
|
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroporphyrinogen III Synthase (UROS) in samples from serum, plasma, tissue homogenates or other biological fluids. |
 Mouse Uroporphyrinogen- III synthase, Uros ELISA KIT |
|
ELI-43929m |
Lifescience Market |
96 Tests |
EUR 865 |
Human Uroporphyrinogen III Synthase (UROS) ELISA Kit |
|
abx576755-96tests |
Abbexa |
96 tests |
EUR 911 |
- Shipped within 5-12 working days.
|
 Human Uroporphyrinogen- III synthase, UROS ELISA KIT |
|
ELI-38419h |
Lifescience Market |
96 Tests |
EUR 824 |
Human Uroporphyrinogen III Synthase (UROS) ELISA Kit |
|
RDR-UROS-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 589 |
Human Uroporphyrinogen III Synthase (UROS) ELISA Kit |
|
RDR-UROS-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 820 |
) Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol) |
|
RAT-5 |
Alpha Diagnostics |
1 |
EUR 1138 |
 UROD Blocking Peptide |
|
33R-8607 |
Fitzgerald |
100 ug |
EUR 180 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UROD antibody, catalog no. 70R-1254 |
 Human UROD Antibody |
|
33006-05111 |
AssayPro |
150 ug |
EUR 261 |
UROD Blocking Peptide |
|
DF7374-BP |
Affbiotech |
1mg |
EUR 195 |
 UROD Conjugated Antibody |
|
C32886 |
SAB |
100ul |
EUR 397 |
 UROD cloning plasmid |
|
CSB-CL025678HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1104
- Sequence: atggaagcgaatgggttgggacctcagggttttccggagctgaagaatgacacattcctgcgagcagcctggggagaggaaacagactacactcccgtttggtgcatgcgccaggcaggccgttacttaccagagtttagggaaacccgggctgcccaggactttttcagcacgt
- Show more
|
|
Description: A cloning plasmid for the UROD gene. |
 UROD Rabbit pAb |
|
A5493-100ul |
Abclonal |
100 ul |
EUR 308 |
UROD Rabbit pAb |
|
A5493-200ul |
Abclonal |
200 ul |
EUR 459 |
Rat UROD(Uroporphyrinogen Decarboxylase) ELISA Kit
ELISA Kit)
