Rat UROD(Uroporphyrinogen Decarboxylase) ELISA Kit

Rat UROD(Uroporphyrinogen Decarboxylase) ELISA Kit

Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

RD-UROD-Ra-48Tests 48 Tests
EUR 557

Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

RD-UROD-Ra-96Tests 96 Tests
EUR 775

Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

EUR 517
  • Should the Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroporphyrinogen Decarboxylase (UROD) in samples from tissue homogenates or other biological fluids.

Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

EUR 673
  • Should the Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroporphyrinogen Decarboxylase (UROD) in samples from tissue homogenates or other biological fluids.

Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

EUR 527
  • Should the Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uroporphyrinogen Decarboxylase (UROD) in samples from tissue homogenates or other biological fluids.

Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

EUR 688
  • Should the Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Mouse Uroporphyrinogen Decarboxylase (UROD) in samples from tissue homogenates or other biological fluids.

Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

RDR-UROD-Hu-48Tests 48 Tests
EUR 544

Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

RDR-UROD-Hu-96Tests 96 Tests
EUR 756

Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

RDR-UROD-Mu-48Tests 48 Tests
EUR 557

Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

RDR-UROD-Mu-96Tests 96 Tests
EUR 774

Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

RD-UROD-Hu-48Tests 48 Tests
EUR 521

Human Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

RD-UROD-Hu-96Tests 96 Tests
EUR 723

Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

RD-UROD-Mu-48Tests 48 Tests
EUR 533

Mouse Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

RD-UROD-Mu-96Tests 96 Tests
EUR 740

Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

  • EUR 7237.00
  • EUR 3855.00
  • EUR 895.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Shipped within 5-7 working days.

Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

SEG479Ra-10x96wellstestplate 10x96-wells test plate
EUR 5124.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroporphyrinogen Decarboxylase (UROD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroporphyrinogen Decarboxylase (UROD) in Tissue homogenates and other biological fluids.

Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

SEG479Ra-1x48wellstestplate 1x48-wells test plate
EUR 509.64
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroporphyrinogen Decarboxylase (UROD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroporphyrinogen Decarboxylase (UROD) in Tissue homogenates and other biological fluids.

Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

SEG479Ra-1x96wellstestplate 1x96-wells test plate
EUR 685.2
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroporphyrinogen Decarboxylase (UROD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroporphyrinogen Decarboxylase (UROD) in Tissue homogenates and other biological fluids.

Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

SEG479Ra-5x96wellstestplate 5x96-wells test plate
EUR 2783.4
  • The Intra-assay Precision is determined when 3 samples with low, middle and high level of Rat Uroporphyrinogen Decarboxylase (UROD) were tested on 3 different plates, 8 replicates in each plate
  • CV(%) = SD/meanX100
  • Intra-Assay: CV<10%
  • Inter-Assay:
  • Show more
Description: This is Double-antibody Sandwich Enzyme-linked immunosorbent assay for detection of Rat Uroporphyrinogen Decarboxylase (UROD) in Tissue homogenates and other biological fluids.

Rat Uroporphyrinogen Decarboxylase (UROD) ELISA Kit

  • EUR 5175.00
  • EUR 2734.00
  • EUR 686.00
  • 10 plates of 96 wells
  • 5 plates of 96 wells
  • 1 plate of 96 wells
  • Known also as Uroporphyrinogen Decarboxylase elisa. Alternative names of the recognized antigen: PCT
  • Uroporphyrinogen III Decarboxylase
Description: Enzyme-linked immunosorbent assay based on the Double-antibody Sandwich method for detection of Rat Uroporphyrinogen Decarboxylase (UROD) in samples from Tissue homogenates and other biological fluids. with no significant corss-reactivity with analogues from other species.

Uroporphyrinogen Decarboxylase (UROD) Antibody

  • EUR 453.00
  • EUR 133.00
  • EUR 1302.00
  • EUR 620.00
  • EUR 342.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Uroporphyrinogen Decarboxylase (UROD) Antibody

  • EUR 913.00
  • EUR 467.00
  • 1 mg
  • 200 ug
  • Please enquire.

Recombinant Uroporphyrinogen Decarboxylase (UROD)

  • EUR 503.20
  • EUR 238.00
  • EUR 1612.00
  • EUR 604.00
  • EUR 1108.00
  • EUR 400.00
  • EUR 3880.00
  • 100 ug
  • 10ug
  • 1 mg
  • 200 ug
  • 500 ug
  • 50ug
  • 5 mg
  • Uniprot ID: P32362
  • Buffer composition: PBS, pH 7.4, containing 0.01% SKL, 1mM DTT, 5% Trehalose and Proclin300.
  • Form: Freeze-dried powder
  • Predicted Molecular Mass (KD): 44.2kDa
  • Isoelectric Point: Inquire
Description: Recombinant Rat Uroporphyrinogen Decarboxylase expressed in: E.coli

Rat Uroporphyrinogen Decarboxylase (UROD) Protein

  • EUR 704.00
  • EUR 286.00
  • EUR 2165.00
  • EUR 829.00
  • EUR 495.00
  • 100 ug
  • 10 ug
  • 1 mg
  • 200 ug
  • 50 ug
  • Shipped within 5-7 working days.

Rat Uroporphyrinogen Decarboxylase (UROD) CLIA Kit

  • EUR 8569.00
  • EUR 4560.00
  • EUR 1052.00
  • 10 × 96 tests
  • 5 × 96 tests
  • 96 tests
  • Please enquire.

ELISA kit for Rat UROD (Uroporphyrinogen Decarboxylase)

ELK6632 1 plate of 96 wells
EUR 432
  • The microtiter plate provided in this kit has been pre-coated with an antibody specific to Uroporphyrinogen Decarboxylase (UROD). Standards or samples are then added to the appropriate microtiter plate wells with a biotin-conjugated antibody specific
  • Show more
Description: A sandwich ELISA kit for detection of Uroporphyrinogen Decarboxylase from Rat in samples from blood, serum, plasma, cell culture fluid and other biological fluids.

ELISA kit for Rat Uroporphyrinogen decarboxylase (UROD)

KTE100023-48T 48T
EUR 332
  • URODencodes the fifth enzyme of the heme biosynthetic pathway. This enzyme is responsible for catalyzing the conversion of uroporphyrinogen to coproporphyrinogen through the removal of four carboxymethyl side chains.Uroporphyrinogen III decarboxylase
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Uroporphyrinogen decarboxylase (UROD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Uroporphyrinogen decarboxylase (UROD)

KTE100023-5platesof96wells 5 plates of 96 wells
EUR 2115
  • URODencodes the fifth enzyme of the heme biosynthetic pathway. This enzyme is responsible for catalyzing the conversion of uroporphyrinogen to coproporphyrinogen through the removal of four carboxymethyl side chains.Uroporphyrinogen III decarboxylase
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Uroporphyrinogen decarboxylase (UROD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Rat Uroporphyrinogen decarboxylase (UROD)

KTE100023-96T 96T
EUR 539
  • URODencodes the fifth enzyme of the heme biosynthetic pathway. This enzyme is responsible for catalyzing the conversion of uroporphyrinogen to coproporphyrinogen through the removal of four carboxymethyl side chains.Uroporphyrinogen III decarboxylase
  • Show more
Description: Quantitative sandwich ELISA for measuring Rat Uroporphyrinogen decarboxylase (UROD) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

Mouse Uroporphyrinogen decarboxylase, Urod ELISA KIT

ELI-09119m 96 Tests
EUR 865

Human Uroporphyrinogen decarboxylase, UROD ELISA KIT

ELI-46765h 96 Tests
EUR 824

Human Uroporphyrinogen Decarboxylase(UROD)ELISA Kit

QY-E02064 96T
EUR 361

Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat)

  • EUR 259.00
  • EUR 2708.00
  • EUR 670.00
  • EUR 328.00
  • EUR 219.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UROD (Asn1~Asn364)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD)

Uroporphyrinogen III Decarboxylase (UROD) Antibody

  • EUR 411.00
  • EUR 592.00
  • EUR 182.00
  • EUR 314.00
  • 100 ul
  • 200 ul
  • 20 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroporphyrinogen III Decarboxylase (UROD) Antibody

abx036101-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Uroporphyrinogen III Decarboxylase (UROD) Antibody

  • EUR 370.00
  • EUR 606.00
  • EUR 300.00
  • 100 ul
  • 200 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroporphyrinogen III Decarboxylase (UROD) Antibody

abx239292-100ug 100 ug
EUR 509
  • Shipped within 5-12 working days.

Uroporphyrinogen III Decarboxylase (UROD) Antibody

abx433428-200ul 200 ul
EUR 384
  • Shipped within 1-3 working days.

Human Uroporphyrinogen III decarboxylase (UROD) ELISA Kit

abx384155-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), APC

  • EUR 364.00
  • EUR 3545.00
  • EUR 980.00
  • EUR 467.00
  • EUR 227.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UROD (Asn1~Asn364)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with APC.

Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), Biotinylated

  • EUR 325.00
  • EUR 2658.00
  • EUR 777.00
  • EUR 400.00
  • EUR 225.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UROD (Asn1~Asn364)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with Biotin.

Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), Cy3

  • EUR 444.00
  • EUR 4685.00
  • EUR 1265.00
  • EUR 581.00
  • EUR 261.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UROD (Asn1~Asn364)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with Cy3.

Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), FITC

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UROD (Asn1~Asn364)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with FITC.

Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), HRP

  • EUR 332.00
  • EUR 3089.00
  • EUR 866.00
  • EUR 421.00
  • EUR 213.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UROD (Asn1~Asn364)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with HRP.

Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), PE

  • EUR 311.00
  • EUR 2856.00
  • EUR 804.00
  • EUR 393.00
  • EUR 202.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UROD (Asn1~Asn364)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with PE.

UROD Uroporphyrinogen Decarboxylase Human Recombinant Protein

PROTP06132 Regular: 25ug
EUR 317
Description: UROD Recombinant Human produced in E.Coli is a single, non-glycosylated polypeptide chain containing 387 amino acids (1-367 a.a.) and having a molecular mass of 43 kDa. The UROD is fused to 20 amino acid His-Tag at N-terminus and purified by proprietary chromatographic techniques.

Uroporphyrinogen Decarboxylase (UROD) Polyclonal Antibody (Rat), APC-Cy7

  • EUR 608.00
  • EUR 6970.00
  • EUR 1840.00
  • EUR 814.00
  • EUR 335.00
  • 100ul
  • 10ml
  • 1ml
  • 200ul
  • 20ul
  • Sequence of the immunogen: UROD (Asn1~Asn364)
  • Buffer composition: PBS, pH7.4, containing 0.02% NaN3, 50% glycerol.
Description: A Rabbit polyclonal antibody against Rat Uroporphyrinogen Decarboxylase (UROD). This antibody is labeled with APC-Cy7.

Recombinant Human Uroporphyrinogen Decarboxylase/UROD (N-6His)

C273-10ug 10ug
EUR 202
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 1mM EDTA, pH 8.0.

Recombinant Human Uroporphyrinogen Decarboxylase/UROD (N-6His)

C273-1mg 1mg
EUR 2283
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 1mM EDTA, pH 8.0.

Recombinant Human Uroporphyrinogen Decarboxylase/UROD (N-6His)

C273-500ug 500ug
EUR 1613
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 1mM EDTA, pH 8.0.

Recombinant Human Uroporphyrinogen Decarboxylase/UROD (N-6His)

C273-50ug 50ug
EUR 496
Description: Supplied as a 0.2 μm filtered solution of 20mM TrisHCl, 100mM NaCl, 1mM DTT, 1mM EDTA, pH 8.0.

Uroporphyrinogen Decarboxylase Antibody

  • EUR 732.00
  • EUR 398.00
  • 150 ul
  • 50 ul
  • Shipped within 5-10 working days.

Uroporphyrinogen Decarboxylase (Recombinant)

  • EUR 2861.00
  • EUR 328.00
  • EUR 230.00
  • 1 mg
  • 25 ug
  • 5 ug
  • Shipped within 5-10 working days.

Recombinant Human Uroporphyrinogen Decarboxylase

7-03796 5µg Ask for price

Recombinant Human Uroporphyrinogen Decarboxylase

7-03797 25µg Ask for price

Recombinant Human Uroporphyrinogen Decarboxylase

7-03798 1mg Ask for price

Urod/ Rat Urod ELISA Kit

ELI-09120r 96 Tests
EUR 886

UROD ELISA Kit (Rat) (OKCD01000)

OKCD01000 96 Wells
EUR 896
Description: Description of target: Catalyzes the decarboxylation of four acetate groups of uroporphyrinogen-III to yield coproporphyrinogen-III.By similarity ;Species reactivity: Rat;Application: ELISA;Assay info: Assay Methodology: Quantitative Sandwich Immunoassay;Sensitivity: < 0.117 ng/mL


EF004103 96 Tests
EUR 689

UROD Recombinant Protein (Rat)

RP235991 100 ug Ask for price

Custom Antibody titration by ELISA up to 2 rabbits and 1 bleed

EUR 202

UROD antibody

70R-1254 100 ug
EUR 377
Description: Rabbit polyclonal UROD antibody raised against the N terminal of UROD

UROD antibody

70R-21183 50 ul
EUR 435
Description: Rabbit polyclonal UROD antibody

UROD Antibody

32886-100ul 100ul
EUR 252

UROD Antibody

DF7374 200ul
EUR 304
Description: UROD Antibody detects endogenous levels of total UROD.

UROD Antibody

  • EUR 597.00
  • EUR 333.00
  • 150ul
  • 50ul
  • Form: Liquid
  • Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity purified
Description: A polyclonal antibody against UROD. Recognizes UROD from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.


  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

UROD Antibody

ABD7374 100 ug
EUR 438


YF-PA15241 50 ug
EUR 363
Description: Mouse polyclonal to UROD


YF-PA15242 50 ul
EUR 363
Description: Mouse polyclonal to UROD


YF-PA15243 50 ug
EUR 363
Description: Mouse polyclonal to UROD


YF-PA15244 100 ug
EUR 403
Description: Rabbit polyclonal to UROD


YF-PA24946 50 ul
EUR 334
Description: Mouse polyclonal to UROD

Rat Dopamine decarboxylase ELISA kit

E02D0232-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dopamine decarboxylase ELISA kit

E02D0232-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Dopamine decarboxylase ELISA kit

E02D0232-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Dopamine decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ornithine Decarboxylase ELISA kit

E02O0013-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ornithine Decarboxylase ELISA kit

E02O0013-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat Ornithine Decarboxylase ELISA kit

E02O0013-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat Ornithine Decarboxylase in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Urod ORF Vector (Rat) (pORF)

ORF078665 1.0 ug DNA
EUR 506

Human Uroporphyrinogen III Synthase (UROS) ELISA Kit

EUR 554
  • Should the Human Uroporphyrinogen III Synthase (UROS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroporphyrinogen III Synthase (UROS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Human Uroporphyrinogen III Synthase (UROS) ELISA Kit

EUR 725
  • Should the Human Uroporphyrinogen III Synthase (UROS) ELISA Kit is proven to show malperformance, you will receive a refund or a free replacement.
Description: A sandwich quantitative ELISA assay kit for detection of Human Uroporphyrinogen III Synthase (UROS) in samples from serum, plasma, tissue homogenates or other biological fluids.

Mouse Uroporphyrinogen- III synthase, Uros ELISA KIT

ELI-43929m 96 Tests
EUR 865

Human Uroporphyrinogen III Synthase (UROS) ELISA Kit

abx576755-96tests 96 tests
EUR 911
  • Shipped within 5-12 working days.

Human Uroporphyrinogen- III synthase, UROS ELISA KIT

ELI-38419h 96 Tests
EUR 824

Human Uroporphyrinogen III Synthase (UROS) ELISA Kit

RDR-UROS-Hu-48Tests 48 Tests
EUR 589

Human Uroporphyrinogen III Synthase (UROS) ELISA Kit

RDR-UROS-Hu-96Tests 96 Tests
EUR 820

Custom production of antibodies in 5 Rats using customer supplied antigen (std 63 days protocol)

RAT-5 1
EUR 1138

UROD Blocking Peptide

33R-8607 100 ug
EUR 180
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of UROD antibody, catalog no. 70R-1254

Human UROD Antibody

33006-05111 150 ug
EUR 261

UROD Blocking Peptide

DF7374-BP 1mg
EUR 195

UROD Conjugated Antibody

C32886 100ul
EUR 397

UROD cloning plasmid

CSB-CL025678HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1104
  • Sequence: atggaagcgaatgggttgggacctcagggttttccggagctgaagaatgacacattcctgcgagcagcctggggagaggaaacagactacactcccgtttggtgcatgcgccaggcaggccgttacttaccagagtttagggaaacccgggctgcccaggactttttcagcacgt
  • Show more
Description: A cloning plasmid for the UROD gene.

UROD Rabbit pAb

A5493-100ul 100 ul
EUR 308

UROD Rabbit pAb

A5493-200ul 200 ul
EUR 459

Rat UROD(Uroporphyrinogen Decarboxylase) ELISA Kit